Transcript Name :
Phyke_g149
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_476772
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin carboxyl-terminal hydrolases family 232.407PS50235
Ubiquitin domain9.744PS50053
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1282
*** None ***
*** None ***
TypeScore
nuclear870
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
obsolete ubiquitin thiolesterase activityGO:0004221IEA
ubiquitin-dependent protein catabolic processGO:0006511IEA
*** None ***
*** None ***
Sequence
        3849 bases(100 bases per row)
ATGGACTCGtgggacgacgacgacgacgtgcaTCGACCGCAGCccaacgatgacgacgacgatgattTCTCCACTTctcgccaacaccaccgtGCTCAAG
TCGCTTCCGTCCTCAGCCAACTGCCACATCCAgtagacgacgacgaaggagatACCGAAGGCGACGCTTTAACGGCCTCCAGTCCCAGTATCCAGTCCAC
AACCTTAACTACATACTCATCCTCAGGATTTGAAGGCCCCTACGATTCTCCAGGCTACACTAGTAATGGAGGCAGCAGTTATAGTAGCACAGGGGGGTAC
TCTCGCCTGAGGAACGCTTTCACAGGCCTCTCAAACCAAGGAGCCACGTGCTACATGAACAGCCTACTACAGAGCATGTTTATGACGCCAGAGTTCCGTC
AGGGACTGTACCGCTGGACGTGCCATAATGCTATCAAGAAGTCCAAGGAAGAGGctaaagaggaggaagagagtgaagaagaagaggcagatgaagacaa
tatcccgttgcagctccagaaaCTTTTTGGCAAGCTACAACTCACGACTCAGGACTCTATCAGCACAAAAGCATTAACTAAGAGCTTTGGGTGGACTGGT
GCTGATGTGTTCCAGCAACATGATGTCCAGGAGCTCTGCCGAGTGCTACTGGATGCTCTGGAACGATCGTTTAAAGACACAGTGAATGAGAATTTAGTGA
ATGAGCTGTATCAAGGAGCTCTGAAGGACTATGTGCAGTGCTGTGAGTGTAAGTATGAGAGCTCGAGGATTGATAACTTTCTGGATTTGTCATTGGTGAT
CCGACCGTTTGGCTCGActgagatgatgaagacagtGGAGGAAGCGATTGAGCTCTTTTTGCGCCCAGAATTGTTGAATAAGGAGAACCAGTGGATGTGT
GACAGATGCAAGGTGAAGAGAGATGCAATTAAGGGACTCAAGTTCTCCAAGTTGCCTTATgtgctgatgttgcagctcaagcggTTTGACTTTGACTACA
CTACGATGAATCGCATCAAGTTGCACAACGAAGTCACTTTTCCTAAGTATCTTGACATGAACTCGTACGTGAGTGATGAAAATGGCGGTGTTCGTGGAAA
AATTGCCAGGAAAATGTCGGAGGAGCGCCATGTGCTAGAAGGCAAAAATCAACATAGCACAGCCCCACCTGAGGAGACGATGCCGACGCTACCCATCTCA
CCCCCTCTTGCGCCTGGATTGCCAGCCTTGACCGAACGTATCCGGCGTCTGTCCTCCATGGATGAATCTCAGCCGACGACATTTGCcaatgatgatgagg
atgatgacgacactGACCAGATGGACGACGGCACCACAGAGTTTGACACATGGAGTCCTACGTTTGACCCGGAGGTTATGATCAAGCGATCCGGACCGCA
TGTGTACGAGCTGTACTCGGTGCTTATTCACTCAGGCAGCGCTCTTGGTGGGCACTACTACGCATACATTAAATCACTAGAGACCGGCAAGTGGTACAAC
TTTAATGATTCGACGGTGAGCGAAATCTCAGACACAGAGCTAAAGACGGCCTTTGGAGGTGCTACTGGCTCTGGGTACAGCATGCGTTACAGTACTTGTG
CGTACATGCTAATGTATCGTCTTGTGTCCACGGACAAAAACGTAAACGTGATCCTGCCGGAGAGCATTCCGCAGTATTTGAAAGATAAGATccatgatga
tgaagagaaaatTCGCAGGCTTGAGCAGGAGCGTGTagagatggccaagaaggtgcaGGTGAAGTTTTTTATGAAGGGTAACAAACCCAAAAGCTTGGAG
AAGGCGATCCATGTCTACAAAACTGCGACTATCGGCGAAGCGCTTGAGACGGCATGCAAGGAattcgccaaggagaaggatgTGGTCGTCCCATCGATAG
AGAACGTTCGGTTGCGCGGGTACAATGACTATAATTGTCTGCTATCGGATACGTACGACGGCAAGGAGGACATGTCCTTGACGTCATTGGGTATTTATGC
TGGTCAGCAGATGTTTCTTGAAGTCAAGAGTGATGATGAACAATGGGAGGAACATGATCCGACCAAGCTACAACTTTTCATCCGCCGTTTTGTCGACCCA
GAATCAGCTGAGGCGAACGAGACTAGCAAGGTATCACTCATGGCGAAATGCCTCcaagtggacgatgaagccaACCTAGAGTCACTTTGTGCTCTCGTTG
CAAAGAAGTTTTCCATTCCGAATGATAAACAAATTCGCCTCATCAAGAAAAGTGCGACGACTTACAGCCTTTCAGCCGCCAAGATCCTGAATGTAAACGA
TGAAGAACGTACGCGCAAACTGCGATTAAAAATGGATTTGCATTTGGTGAATGGGACAGAGCTGTATTTTGAAGAGACAGCAGATCTCACCCAACCATCA
TCTGCTGAAGTATTCTTCGAGCGTGAGGCCAACATGATTACAGTCAATTTCAAATATCTGTCGCGTGTAGCGGAGCCCATTCGAATCGACCGAAGAGAGA
CAATCCGCACGTTAAAGGAGCAGATCAGCGCTAAGATCGGTCTGTCCCCGAATCAGTTCAAGATTTTACGCGGCATCAATAGCGCCGGTGTCGAAATCAA
AGCTATTGACAGTACTCTGTCCAAGCTCTCCATTGGCTCTAATCATACGGTCTTCGCATTGGAAGGTGTCCCATTGAACACGGGCGAATACAATTTCAGA
CTAATGTTCTACCATCCCGCCAAGGCCGTCCCGAATGCTTCGAACTTAGCAACTTCGAGTAACGATAGCAACAATCAGAGCCAGCAAGCGACTGTGGCGA
ACACGTCTGCGGATGGCAGCGACACCCCAGATCTGTttgatattgatgatgtgctggtggcgacaGGGAAGGATGATTCACTACTGACATTTGTAAACCA
CATCGTTATCAGTGAGGAGATGCTTGTGGAAAATATCCGCCAAAATGTTTGGGACGAGTTGGTGAAAAAGAATTTAGTGAAGGATGACAGCAATTTGACA
CCGTCTCATGTACGCCTCCGTGATCTTCGTCAAAGTACCATGACAAGCGTGTTAGTGGATGGCCAAAAGCTCGTAGAGGCGTCGAAGTTAGCTGTATACG
AAGGAAGAAGTATCGTGGCCGAATTATTACTGGAGCCTGAAACCTCAGAAGTCAACCATCGCGTTGTCGAGTTTGCGTACGTGAACCGTGCAACGTGGCG
CTTCGTCAAGAATATGCGGCGCGAGGTAGTGATCTCCTCTTCAGAGGAAAGCACTCGCCCACAGACGTATTTGGTAGACGCCGCAAGCGCCGCACTATCT
ATTCCAGTCGAGAGGTTGCTCTTCGCACGTATCCCGTATCATCGTGACTCGATTGATATCCTCGAAGTAGTTTCGTACGAATTCCTACCTGCAGCGGCCT
TCGTGAACAAGGACACAGAATACCAGGAGCTCTTCTTAGTCATCGACACCAATGTCCACCTCACGTACATGAACAACCACGAGCGTCAGCTCATTCAGAG
CTTCCtagcgaagaagagcgaggagaaAACCCGCGCGCTGCGAGCAAAGtactcgtcgtcatcttaTAGTAGCAGTAGCACGTACCAGTACCAGAAGCCC
AAGGAGGCTGCTCTGGTGATTCGCACCAGGTCCAGGACAAGTGAAAAGGAGCACAAAGGTGGCAGTGTTGGGAGCAGCAACGGTAAGAACTCGAATGGCG
TACGAATTCGCACGCCTACACGGCGCTCTGGAAAGTCTGGATCCGCCGCGCATCACGCATCCTCCGATactgacgaggaggacgacacCGACTATATGGC
GGAGAAACCTGAGACCCTCGACATGGACCTCTTTGGGGACCTGTCATAA