Transcript Name :
Phyke_g177
Orientation:
(-)
Number of Exons:
6
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain11.081PS50297
SPX, N-terminal22.115PS51382
HmmSmart predictionP-Valprediction_id
Ankyrin repeat0.034SM00248
Ankyrin repeat2100SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
SPX, N-terminalIPR004331
*** None ***
InsideOutsideTMhelix
1-580
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4013 bases(100 bases per row)
ATGGAGTCCGCTGAGCAGCGCCCGGGGCTGTGTATGTCTGTCGAGCAGCGTACGAAGCTGCGCCTGTTCCTGGGCGCAGCATCTCGTGGGGAATTAAAAG
CAGTGGATGTATGGCTCTCGACTGAGCCCGAAGGTTATGTGAATGCAACGTTGGGGGAGAAATGGACGGCTCTACATAGCGCCGTGTCGTTTATTCATCT
GAAGGTTGTGCACCGCCTCCTGCAGGAAGAGACCATCGACCTGAACGCCACCACAATGTATAATTTCAATGATGCAGTAGTACATTGAGGCTTGCAATAT
ATTCTATTGCAGATATGGCTGACTTTGTGTGCTGTGGTTGTGAGCTAGAACGGGGTTGTCGGCATTATCGATTGCCTTCACTCGCAAGAGCAACACACTG
ATGTCTCTGTTGTTGATCAGCGGGGCCTCTCGCGCTACGTTGTGTGAGTGTGTTGAAGGTTTGTGTAGTTGAATGGTGCAGTTCTGATGTTTTGTATATA
GCAAATGAACTGTGGCAGGAACTGGAAACGACCAATTGGGTCCACGATGATGTTTGGCAGATGCTGTCGCCTGGCTGGGCTCTGGTGTGGACTCCAAAAT
TGCATCGCCATTTCCCGCCTGGTGAACGTGAAAAGTGTCGCCTTATAGTGTTTGCGAATGCACTGGCATTACGATATCATGATCCGATAGCAATCGGTAA
TGCTACAACTTGGAGGGCTAAACTGGTTCAGCTTTTTTGGAGGGTGGCCGCAGCTTGGACAGAACAAGGAAACCCCGTTCGATGGCGATACCTACCGCAA
CCGTTGGTCTACCACATCATAGAGTACGCCGTGTATCTGTGGTGAAGAGCTCCCGTTGAAGATACGCTGAACTTTATTTTAGACTTGAGTCGGGGATATC
TTTGGTGCCACACAAAggttgctgcttggcatATCACCAGGCTGATCAGGTCACTCGACGACGGTACAACGTTTGCGCACCAGCAAATTCTCCAAATCCT
CGGGGATATCTTGTATGCTGTCCATGCGACGCAGGACACGTGCCCAGATGAGTGTCGCCCGCCCTCGGAGATTCAATTGTAGATGATGAAGCCTTTACTT
CAGCAGGGGAGAGATTCATCGTGATGCTGGAAGTACATGCAGATAAAACACCATTCAACACCActcaacaccagcaaaatcGACAGTCGCAACTGGGTCA
AGTGCGTGTATGTAGAGCCTACCAAGCAGCATAGACACTTGAAGATGCGAGGGGCAATGGTACAAAAAAACGGGAAGCAACCGTTCGCGTATGATCGACT
GGTGGAGCACGTCTGGGTGCACCTGCACTTGCAATGCAAGTCTTGTATGCATGCCCCCTCCGCATCAAACGCGCAGATCTCCACATTATGGTCCAGTTTA
CAGTAATTTCCTCtagttgttgttgttgttgtttttccTATTAGAATCTCCCGTCCAACAAGGTATCTTTGCCGCAAAATCAACGTCTTCTCTTTGACTG
GACAGCGTGCatccaagcagaaactcTGCATTTGAATCTGAGCCATGTCGGGTAACAGCAGGCGGAAAGAAGAGACGCGTGCCAGAGGTCCGATGGTCTT
TCATTGCAATGAGTCAATGCGGTCCTGAAGGCTCTCCACACAGGGACATTCGTGTCAACCACGGGCGTTGTTGTACACTATGTATTGATGGAACTATGGG
TCTTGGCACCTGAAGGTGATGGAGAACCAAGCACGTGCCTTCTGAAATGGGTCACCTATTTGAGACCACCGTGGTGAACTGGCTGTTCACCTCTGTCTCA
TGCTATGCACTTGAAGTGTAAGCCTTTGAAAATCAATGACATCTCGTAAAATGATTCTATTAAATTGCATTACTCTAACCAAATAATAGAGACATAAAGA
TCTTCCATACAAAACATCAAAGCCCATCTTTTTCAGGTCTCTTTATCATATTTTAAAGACTCTTTATTGATCTATATATCATTTTTCTTTATTATATATG
CCAAACTAAAGGTTTTTCTACTCGCGGATAGGGCTTTTTGGGCGTTctttttcctcctcctccccTTGCCGCTTTGCAGCACACAAAGCGACAATAACCG
ATCGCCTTCGGCCACCCATAAACATACATCACACTATTAGAATAGCTGTCTGCGTGCCTTTGCAGGTAATGTACCTATCTACGATGGTCTAAAATGCATG
TTGGTCAGTCCGAGTTTTGCGTGTTTAAGTGAAGGAATGGGGAGAGCGGAATAGTTGTTGAGCCTTATCTCGCTCTCTCTAACCCTTTTGGGCCCAAAAG
ATTCAGGTGTTTCTGCTTTGAATCTCGGCGTCCGGTTGCTGTTCGGTTTGTGCCAAAAGTTTAGGCTAAACGGCTGACTGGTTATCAGTTGTTGTGTCTT
GATTAGAGTCACACTGCAATTGGGTACCTGCAGAAGACGCAGTGCTGTGCAGTCGCGTTAAAGCTCAAGGGAATAAACGTAGGGAAAACAAGGGGCCAGA
GACAATGAAGTTCGGaaaggtgctgcagcagtcgacgcAAATGTCGCCCAGCGCATGGGAACCGTACTGGGCCGACTACAAACTactcaagaagatcatc
aaGGACTGCGCAcagatcaagaaggaggagaagctgcagggCGACGTCCTagtcaagatcaagatcaaaCCCTCGGCCAAGATGGACAATGACAGCATTC
GTGCGTAAACTGTTTTGTGTTCACCCTAAACGTTTAGACATTGACTAACCACTGTCGTTCTGTGGCTAACGCAGGCCAGTCGGAGGATGAGACCAACTTT
TTCCGTACGTTGCGTGCTGAGATCAAGAAAATTGCCGACTTTTTCCTTAAAGAGCAGGCCAAACACACGAGTCAAGTGGCTGCCATCGACGGCAGTTTCC
AACAGCTAAAGGTAAGaacgagaaaaaaaaacttaaACAGTGGTGGACATATGTACTTAACCACACATCTTCTTATTGTAGACAAATCCTGATTCAGCGG
AGGCTAAGACTGCTCTGATGAAGAGCTGTGTGTCTCTCTATAAggagcttttgctgctggaaaacTTTGCCGTGATGAACTTCTGCGGCATTTCCAAGGT
AAAACTTTCTTTATCTACTTAACCAATCACTAAACCACTATATCCTCCACTTTTTTCTAATTATTTCTATTTTTTAACTCCTCAGATCCTGAAAAAGCAT
GACAAGTGGACGGGATATGCCACCCGTAACAAGTTCATGCATACAATCCTCATGAAGCAGCCTTTCGCCACTTACGAGcctttgctgcagatgatcGACC
GCCTAGAACATATTTTCATGCAAGCTACGGGCTCCAGTATCGAGCAACATGATGCTCAAAAATATTCTTCTCGGCGTGGTGGAGGCGGTAGCTCCTCATC
TTCGCCCTCGGGGGGTGCACCAGGGGGCTCCGGACACTTTGGGGCTGGTGGCGACAATGCGTCGCCTAGTGCCGAGAGCCCTTCGAATCGGTCGCCAAGT
CACACGCCACCGGGGGCTAGTGGCGGTCGCCCCCATGACGGACACAGGTATAGAAGAATGGTGGATGAAGCTTCTCCGAGATCGGAGGATTCAGTCACGT
TGGTGCGAGTGAACGCGTTGAGGGACGATGTGAGAGAGTTCAGGAAGATTGAGAGTGCGTATGACGGGGATGGAGAGTATGAGGAAGGCACGGATGACAC
AGGGTTCCCTGAGGATGAAGCGGAGGCGCCGCCACCGCGCTTTGGTGGTCGCCCTCAGGAAGAACATCGGGAGGTACCCCCGTCGCTCCCGCTACGTGTT
GCCCCTACCGGGACCCAATCGGacagtgatgctgcagcgattgCCATGATGTCCATGAAAAATAGCGCTGGGCTGCATGCGGTAGGAATCAGCAGCGACG
GTGGCGATAGTGCGGCGGAGGGATGTCGAACTCGAAGCGTCAAGCGCAAGGCCTGTGGTCCATTGGACTTGGAAGGTAAGCGCAAGATGAGCGTGACTGC
CATTCTCAACTAG