Transcript Name :
Phyke_g182
Orientation:
(-)
Number of Exons:
4
Description :
caltractin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain16.773PS50222
EF-hand domain13.314PS50222
EF-hand domain13.119PS50222
EF-hand domain13.816PS50222
HmmSmart predictionP-Valprediction_id
EF-hand domain1.3SM00054
EF-hand domain6SM00054
EF-hand domain0.0025SM00054
EF-hand domain2.6SM00054
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-187
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        781 bases(100 bases per row)
ATGGTACGATGCCGCCACGTAGTGATCTCTTGCAATATTGAGATGATAACGACCTGCTTGCATGATGTTGCAGTCTAACAAAATGTCGGCATCAGCGTTT
GCGCGGTCTCGCGCAGCTATGCGACGCAAACCCAAGCCCGTCAAGAAGGTTGGTAAAGCAGAATTTAAACTTATAGACTGGTATGATGCTCGCGTATGGA
GTTTTGACGAAACTGCTAATGtcaggtgctggacgaagaagatttGGAAGAGATCAAGGAGGCTTTCCACCTCTTCGACACGGACGGCAGTGGATCTATT
GACGTGCGTGAGCTCAAGGCTGCAATGCGAGCGCTCGGTTTCCaagtgaagaaggcggaaATTCGACAGCTTATTGCTGATATTGACAAAGACGAGTCCG
GTACCATCAATTTGGACGAGTTCATTGAGATGATGACGGGAAAAATGGCGCGTGTTGGTGGATATAACTGCTGTGATCTTGCAAGAAGTTTTGCATCTGA
CCATTGAATATCCTGCTCTATAGAATTCGAGAGACTCGCGAGAGGAGATCACGAAGATTTTTCAGCTCTTTGACGATGATAATACGGGTAAAATCTCCTT
CCGCAACTTGAAGCGAGTGTGCACAGAGCTGGGTGAGACTCTGACGGACGAAGAAATGCAGGAGATGATCGATGAAGCCGACCGCGACGGTGATGGCCTT
ATCAACGAGGAGGAATTCTTCcgtgtgatgaagaagcgcacCGGCAACCCGCTGGACGACCTggacagcgatgatgacTGA