Transcript Name :
Phyke_g175
Orientation:
(+)
Number of Exons:
2
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-354
NN-scoreoddsWeighted Score
0.885.4710.011
*** None ***
TypeScore
nuclear826
GO
*** None ***
*** None ***
*** None ***
Sequence
        1152 bases(100 bases per row)
ATGGTGGCAAGTGGGGACAACGTTGATGCGACTTCAGGCGAgactgtcgctgctgttgcttccgTGGACGTCGAATTAAAGGTCccaaatgaagaagccg
TGGGAGACAAGCGGAAGGAGCGCTCGGACGACGTTGACGCCTTCATTCCAGgcgacgagagcgacgtcCCAGTCGACGCTTCCCTCGTGGTACCCAAGAG
CTCGGAAGACCCGGACGCCACTGAAGATGAGTCGATCCATGAGGTTATGGCCAATATCAAGGACTCGGCAGGTGCAGACGTGACTTTTGAGGCCCCTACG
GACGCCGTGACGCCCCCAGATGTTGTGAAACCCGAGTCTGAAGCGGAGGCAGCCGCAGTGGAGGCCGCCGtcaatggagctgctgctgaagcgcagcagT
ACAACAGCAAGCGCATGTCACGCGTGTCCTTCAACTCGTGGTTCGACTTTGACGCGTACTTTGAGCTGTACATGCAGGAGACGTTCCAGCCCTTCCGAAT
GCGCTCGTCCTGCAGTGTAGAAGCTTATCGACGCAACCAACAGAAGGTCATGCTCAACAATAAAAGCTCCCGTGGACGTCGGGCGGAATTCCCTGATGAA
GCCATTCATCACCATCGGATATACATGTGCACCCACGCCATGAAGGCGCGTTGCCGCGGGGCAAACACACGCCCTGGACAAAAGTATCGCGGGATTGGAT
GTACCGCCAAGATCAACGTGAAGATCACCCCGGCAGATAATGCAGCCAAGTATATGGTGATCGTTACGGACCAGGTAAGCACTACAGTAACAGCTCAGCT
ACATCTCTTGTGATCTGGTTATAACTCCTGTGTTGCCGATTGCTGCCGAATTTGTGTGTAGGTGGTGACGCACAACCACCCGGTGAGCCGCGAGATCTAC
GAGGCGTACCCGGAtgtgctgctcaagatgaTGCGTCGTAGCCAGTTGTCGCAGACAATGCTGGGGCACCCGCCGACGCCCAAGTTCGAGACGCCCGGGC
AGGCGCAAAAGTACGAGCGCGCGATGGGCGCGTTGCAGTCGGTGGCTGAGGCCATGGCGCGGCTTCCTGACGAGGactacgagcagcagctgacgcAACT
GCAGCGGATCTACGCGACTTCGCCCGATCCGAACGTGTCGTCGGTGGTCTAA