Transcript Name :
Phyke_g168
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PITG_02639
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-281
NN-scoreoddsWeighted Score
0.6643.4330.007
*** None ***
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        846 bases(100 bases per row)
ATGGCAATGACCGCAGAGGCTATCACAGCGGAAGGTCTAGGAGCCATTCATGATGCAACCGAGGAACTGACGGAGAAATCACCACGCGATACATTGCTCG
ATGAATTCCGTGCAAGTTTATCAATCCGACAGCATCCAGCCAGTGTCTCGCCAATCAAGACGATCGCTTCGCCTGGGTTTATGGAGTGCGAGTGCGCAGC
TACAACAAAGAGGAGTCTTTATAACGAAATGGGATGTGGGGCTCACAACCTTACGCTACGGAACTCGCGGTTGTATCCGGATGCACTGGGGGCTTCGCAA
AAGATGACCTCGCAACTTCCTCTGTCACCACTTTCCAAGTCGATGGTATCGTTACCATCTCCGAAGCAGTCGCCAATGAAGTCAATGGGTGAAGACCTCG
ACTCAGTGCTGTTGCGGGCATCGAAAAGCACGAGCTCACtacgtcagcagcacaactTCTCGACTGAGCCCAGTATTTTATTGTTCCCATCGCTATATTC
CAAGGGTACTACACGATCCCACAATAAGGAGGACGCAGTTGAAGGAACGAACGGACGAAAGACTTCAAGTGTATTTTCGCCGTCTTCGTTGGCACTAGAT
GCACAAAGGACACTCCCactccaagaagctcaacgCATGCTCGAGTTGTACAACAAGATTATCAAAGTGGGCGCAGAGACGAAGAAAAACATGTCAATTT
TGTACACAAGGAGATCCACGCTCTTAGCTGCGATGGAGAACTTCCAGGCAGCACTGCAAGATGCTGAACATGTTGTACTTTTGGATCCGAAGTCGGCCGT
GGTGCGTCTAATCGACTACACGATCGATTTGGATGAGGAAGCGTAG