Transcript Name :
Phyke_g139
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_553034
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Forkhead-associated (FHA) domain7.187PS50006
Cyclic nucleotide-binding domain12.601PS50042
Forkhead-associated (FHA) domain9.094PS50006
HmmSmart predictionP-Valprediction_id
Forkhead-associated (FHA) domain1.2SM00240
Cyclic nucleotide-binding domain1SM00100
Forkhead-associated (FHA) domain2SM00240
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-1045
*** None ***
*** None ***
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3138 bases(100 bases per row)
ATGGACGCTGTCCATGCTGAAGTTTCTGTAGCAGGCGATGATTACCTTGTGCGTGACGCTCAAAGTACGACAGGTACTTTCCTATGCTTAAGCACTTGTT
CCAGACATTATCCTCAACGAGATGGCTTCCGTCTGCGTCATGGCGACGTCTTCCGTATTGGACCATCGACTTCTATACgtgtgctggagcttgggACCAC
CACTGCTACCACCACCATTAGCTGTGTGCGAAATGATGAACTCAGCCTTACGAAAACCGACCGTCCCAAAACAATCGTTGAATTCATTGCCAATGCTTCT
CCATGTGTGCTGAAGCGACCGTCGACTGAGGAAGAGTTCCGTCTCATTGCTTCCGACATCGAGGACGAATGCAGAGGTATCGTTAATGATGCTGATACTC
GATGTCTCGATGCTGTAGCTCGAAACGAAGAAAATGAGACTAGCCCAGCAGGAGTTCACCGCAGTGTTCAATTTGTGGACACACCTCCTGTCATGTCGGA
TGGATCCGTATTCCTGGGCAGTCGCTACCTGCGCCAGGAAAGCAAGAATCGGGATTTTAATGAGCCATCAGAAgtggaagatgaagatgacgacgtggtC
AAACACCTCATTGGACGTGAGCCTCAACTTCCAGAGCAATGTGCTAGAGCTTGCGCACCTCAAAGCTGTCGCCCCGCATCCGTTCGCCTCCTTATCTTCC
AACACGACCCTGCTAAGGCTGCTGATCCTCTTAAACCTCACAAGGCTCGCGAAGTGATGCTGTCTGGTCAGAATACATATCTTATCGGATCCTCACCGAC
TTGTGATGTTCGCGTTTTTCCATCGGAGGGTATCGAAGTGCAAGCTGTGCACTCTCGAATCACATTTGATGGTACATCCTTCGTGTTGCAGGACCTGTCA
TTTGAGCGAAATCTACGACGACAGACGCGCGTGTTACTCAACCAGCGCGCTGTTCGAGTTGTTCGTGGGGAttggttgctgcttggagcaTGCGCCTTGC
AAGTGACGACAGTCACGAAAGCCTTCGGCTGGGACCGCCGTTCTGATATGAAAGAAGCTGCCATACGTTTGGATGTTCTGCGGCTGTCAAAGCGTAAACC
ACGAACCCGTGGCATTTTCCTTCCTGTTGGCTTCCGGTTGATCTCCACGTCGGGCTCGGGGGCATCCAGTGGGAGTAACGGTTGGGGTGGTAGCAGCGGT
GGACCAGTGATGTTCGGCAAGGGCCGAGACTGTGCCGCCCAAATCTTCACAGCGTCTTTAGCTATTGAACAGTTTAGCGTGCAACTCGAGCGCGGCACTT
GCTTGCTCACGCCTAAGGCCACAGGAATCAATGCCGGCACGTACTTTCTCATCGGTCGTGATGACCCTGGTCTGCCTTCAGTCAATGATAGGAGCGGCGA
TACACTAAATACAGAGCGTACACaaaaagctgaagcagctgacgTGGTCAAATGCACAAGCAAGCCCCTCTTGCTGTCTGAAAATTGCGTCTTCCGGTGC
GGTGGGTGTGAATTGGAGGTCATCTATGTGAAGAGCACAGCCATACCAACAGACGGGAAGAGCAAGGCAGCTattgaagagcaggagcatATCCAGTTGT
TGAGTAATATACCGTGGTTGCAGCCGATCACCCACGACCGGAAGCTTATCGTGAGCCTTGTGCGGTGTGGTCAGAGACAGCGACTCGTCGCTGGCGACGT
GATATACGAAATAGGCGATTCTGCCAACTTCCTTTTCATCGTGATCGCGGGTGAAGTGAGGCTTCTGAGCTtgagcaacagcgacgacacaGATGACATG
CAGGCACTCACAGAAAGAGTGACAGCTGGAGGTTTTTTCGGAGAAGTGAGTCTGCAGAGCCCATCCGGATTATACAATTTGGCGCCTAGCTCTGGTGGTC
TTGAGTATACAGAAAACGCGACTGCGACCACCGTCTGCGAAATCCTTGCGTTTGCCAAAGAGGATTTCTGCGGGTATTTGGAGATCTACATGGATGTAGT
GCGTGCTCATCTGCGGTTTGTGCAGGCTCAGGATAAACTCATCCGAGTGGCAAGCAACGATGTGCCATGGCTGCGCGGTATTTCACTCCAGGAAAAGCGT
ATGGTTGCTGAAAACGCCGAAATCGCTCGTTATGTGCACGGGTCTGTCTTGTTCGACGACGGGAAGCTGTTTGTACCTACAGCATCTTTCCATGACAGCA
CACCACAACTTCGAGGGGGACTTTTGGTACTTACCCGTGGCAAGGTATGCATCATTCGCAACAAGAACGGGAGGCAGCGACAGTTTAAGCCCCTCGAAAA
TGAAACgagtgaagaggaacaaCAACATCTCAAAGGAGTGCCGGAtgtcgaggaagaggaagaagatcTGGACGAGTGGTGGAATCCAAACGACCCGGTG
ATAGTAGTGGGCTCGAGCTCGTCTCCGACAATGTCCAACATCTGCGACCTGTCGGTCCGCCTGGAGGCATACTCCACAGTAGAGTGCTTGTTCATCGCAG
AAGCACACATCGCTCATCTTGTGCCAGGCGTGTCCAAGCAGGAACTAAGCAATGACCATCCAGCAGTGGTCCAATACTCTACTCCATTGGCTAGTGGCAA
TTCACTGGTGACACAACGTAGTCACCACTCTCAGGTAGTCAccagtggcagtggagacgatgacagcgatggaagcgatgatgatgatcacCATCCACTG
GGCAATTCCGATGGGAAGGGTGGTCGGCGTCGCTGGCGgcgcaagaagcgcaataaacaacttctggaacagaCTGTGCTAGAGACGCAAAACGACGCAC
AGATACCGAACGCACTGGTGCTTTACATGCTAGCAGGTGCACACCGCGGGGATATTCACGTGGTCCGCAACGTGGCAACCATAGGTGGATGGCTCAGCGG
AGCGGGTATTGAACTCAATGATCGGTACGTCTCCCGGTCGCACGCCATAATTGAATACCATGACAACAAGTACTGGCTGTAcgacagcggcagcaagtGG
GGAACCTTCGTGCGGCTTGAGGAGGAGAAAGTTGTCGATGTCCACCCTGGAAATGTCTTTTTGGCTGGCGAGGTTGAGTTCACGTGTCTGGGTTCGTTCC
CAGAGCGCAACAAGTCCAGTATATGCTGCATAATGTAA