Transcript Name :
Phyke_g161
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Glutathione S-transferase, N-terminal9.201PS50404
Glutathione S-transferase, C-terminal-like7.709PS50405
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Glutathione S-transferase, C-terminal-likeIPR010987
*** None ***
InsideOutsideTMhelix
1-386
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1611 bases(100 bases per row)
ATGGATCAACTGGAAAGTGTAGCGACGTGTCAAGCGAAGAATGGACCTCTGAACAAGCAACAAGTGACTTTCCTGAAATCCGTGATGGAGTGGCAACTCG
GAAGCGTATCGTCGCGGTACAACGGGTGGCATCCTAAGCTGTTTTACGAATCCCGGGAAGACTCAGGCAAGCGcgatgtgctggtggtggatgtaCACAT
GGATGGCCCATCGGCTGGGATCCTGGATGCGTGCTGCACCTTGGTGTGGGTGGCCTTTTCGTGGAATTTTTCATCGTGGACAATGTTATATATGCAGGTC
CAATGTTTAGCAGCTAAGAATTCCTGACGCCGATCAACGAGGGTTTGAACGATAAATAATTAAAAAAATGTTGCTGGCAATGCTTCCTCCGAAGTGGGCG
CAAAACTCTACCTGTGCATTGAGGACTCAAGTGGTGACGAGGTTTAGGAAGTATCGTCAGTGGACAACCTTCTGCAATGAGAACACAGATCGTATCTTTG
GTGAGCATTTACCATCGATTATTGCTTGCATTTTAATCGATCTTGTGAATGCACTCCTAATTTTGACGTGTGATGTGCACACAGATTGCGTGAGACCATG
AATGATCTCGCAATCGGCATAAAAGATTTTgtactgaagaagaacagggATCTAACCCCAAGAAGCATGCTCCGTAATTCCAAACGCTTAACGACATTTC
TCTACCCTGCTGCTTCGCCTCCTTCGAATCTGCGTGTTTCATCTAAATGCTGCTTTTCGTCAGTGAGTCCAGGTCGAGACTCAAAATCTGTATTGGTGAC
TATCCCCGCGTCGAGTTATGCTGAGAAAGCTCGATGGGCTTTGCGTGTTGCCAACATTCCGTTCACCGAGGAAAAGTGGGCTCCTTTGTTTGTATACACG
TCCACCGTTCTCAAGGGCGGTCGATCTGTTCCGCTGCTGACACTTGACTCTCCAAAAGTGACCCTGGCCGACAGCGCAGATATCATGGCCTTCTGTGCCG
AAAAGACACCAGAATTACATCCAAatgacaaggccaaggaaTTGGAGAAGTTCTATGATGCGAAACTGGGACCTCACGTACGTCGTTTCGGTAAGCTAAT
CGTAGGTATGTGTCATTGCAGTTGTAGACTAACTCAGCTGAACGCATGAGCAGCCTATTTCCTCTGGTTCCAGGATGAACATGCCTCGAGGAAGATCATG
ACGGCTCCACTTGATGGTTTCATCCGACGTTCGTTGGCGCAGTTGGCATTCCCTTTCTTGAGGCTTATCCTGCTGCGTGCGATGAAGATCAACGAGAAGT
CTGCAGAGAGATCGTGGCCTCGGATCGAAGAGATCGTTAAAGATGCAGAGAAGCAGCTAGGTGACGGCCCAATCGGCTCTCACTTTCTCGCTGGCGATAC
GTTTTCATCCGCAGACATTGCATTCTGTTCCCATGTCGCGTTGCTCGTCCTTCCCCCCGAGCACGAATTCATCGCGCCGTACATTTCGCTTGCCACGATT
CATCATCCAGCCTATCGTGAGCGACTCGAAGAACTTCATCACTCTAAAATTGGTCAGTATGTGCTATGGTGCTACGAGCACAAACGTCCAGAAGGCAAGA
AGTCATTGTAA