Transcript Name :
Phyke_g135
Orientation:
(-)
Number of Exons:
3
Description :
calcineurin-like phosphoesterase, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8230.87719
InsideOutsideTMhelix
493-511
1-469
470-492
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1705 bases(100 bases per row)
ATGCGGCTGATACTCCTCGGttcgatgctgctgcttgcggggaaagcagcagcagccccTGGCCGCATCTTGCACTTCTCCGATGTTCACTTAAACATCT
CAGAGACGTTGAACCCCGAGGACTCTGCTCGCATCCCCATCCGCTACTTCTCGGACGCCCCATTGGCACTACTCGAGTCTGCACTGAGTTACGCTAAACA
GCACGTTACAAGCGACCCAGAAGTGTTTCTATACACTGGAGACCATGCAGCCCACGGATTATTTACGGACGAGTACATTGCAAAGGCGGTAGAGACCAAT
GTCCACGCAATGGAGAATTACTATCCACCTAAAACTCAAGATGGGGGGATACTGGAGACCACAGCGATCATCGGCAATGCAGACGGAAGTAGGTGCAAGT
TTAAAAGAGttattttgttttactgTAGGAGTGCGTACTAGTATTTATGATGGTGATGTGCTTTGTGTGTAGATCCGGACTATCACATGGAGGTGACGGA
CCCTGCAACGGAGACAAACCCGACCATTGAGTTAATTTCAAAGGTCTGGGAAGACTCGCTGTCTGATGTGAAAATGGACTTGCTGAACCGTAGAGGATAT
CTACGTTATGCCCTGGACAAAAAGCTGCATGTGATCACACTCAATACCGTGCCCTACTCAGTGCGTTTCAGTACAGCCTATTAGTTTTACAAATTTGGTG
AATGGAGCTAACTGTAAtgtcttgttgttgcttgccCACTTGCAGCCAAGTCATCTCCCAGACACGTCGGAGCAACCAGACCCATTTGGACAGTTTGCCT
GGTTGGATGAAAcacttgctgagctgcaggAGGCCGGGAAGTTTGCTTATATCGCTGGCCACATCGCCCCCATTGTGGATTCGTACGGGGGCAACCCGCA
GTGGCACCCCAAATACATTGTGAAGTACAAGAATATTGTCGGCAAGTACGCCGATGTGATCAAGGCGCAGTTTTTTGGTCACGTGCACAGCATAGAGTTC
CGCGTGCCCGTGGAGACGTTGGGCGGGGTGGGGCACGTGGACGACGCCTTTCAATTACTTCCAATGTATGTATCAGGCTCGATCTCGCCACTTTTCGGCA
ACAACCCTTCCTTCATGGTCTGGGATTTCGACACAGAGACGTACGAGATATTGGATTACGCTGTGTATGGCAGTGACATTGCGGAGAGCGATCCACAACT
CAATTGGAAACTTCTGTTCCAGGCGAGCAAGGTGTACGGACTTGCTTCACTGTCCGGGAAGGATCTAACGGACTTTGTGCAGCGTACTCAGCAAAATGTG
AGTCTGCTGGAGGACTACTACTGGAACATGAAAGCGAGGTCTCCCAATTCCCTGCCTTGTTCGGATGCACAGTGCCACGCTAAGACGCTTTGCACGCTCA
AGTGGTGGACCACAAAAGGCGAATTCCTGGCGTGCTTAGACACCGCCCAGATGATGCTCGCAAACCGTGCAACCGACATCGACCAAGCTGCGTCCCCAGA
acatgcagctgcagcgatttcatcctcgtccGGTTCCTCTTCGCAACAGGAAATGGCGGCGAAGGACGTCTTCATGACGATTGGATCAACTGCACTAGCG
ACAGCTACGGCAGTagctggtgtcgctgtgaTCATGCAACTACTCAAGCGCAACGGTATCTTCAAAAACCGTGCGCAGTACCAGAATGTGTTGTCCACGC
TTTAG