Transcript Name :
Phyke_g157
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5840.75320
InsideOutsideTMhelix
1-428
NN-scoreoddsWeighted Score
0.7683.2720.007
*** None ***
TypeScore
extracellular, including cell wall333
GO
*** None ***
*** None ***
*** None ***
Sequence
        1362 bases(100 bases per row)
ATGACCCGGTTCATGTTCCACCTCAAGCTGATCGCGTTGCTGTCCACAGTCTCGTCAAACTCGTCTGCAGTGCGGTCACTAGACCAACTTcaaacaccac
catcaccaccatcgccatcaaATTTTGATTCGACTGGAGCGATATCTCAATGCGACTTCAGACACCTGCACCCTCGACGCTATGCTGCATACCACCTACC
TCATCCATCAGACATCACCATCGATGGGGTTTTGGACGAACAGGTCTGGAATGAGGTGCCTTGGAGTGAGACGTTCCAAGACATTCGGGGCCCGCAGTTC
TGGTCGCAACCTTGGTTCACTACGAAAATCAAGCTGCGCTACGACGACCGATTCCTTTATATCGGTGTTTATCTAGAGGAGACCGAGGTGTGGGCCAATG
TATCGAAGCGCAACGACGTCGTTTTCCATGACAACGACTTTGAGGTGTTTGTGGATGCCGACGGAAGTACGCACAACTACAAAGAGTTTGAGATCAACAC
TCGAAATGTCACTTGGAATCTGTGGCTCAACCGTCCGTACAGAGATGGCGGTCACGAAAACAGTTCGCGGGTAGATCCGGAACATGGTTTCGACATGTTG
GGCAGTGGGATGCGCTCTGCCGTGTATATGAAGGGCCGTCAAGGAGATCCATGTACGTGATTGTGTTTTGACACTGAATAGTGTCATGAAGGCGTCATAA
CTTATTTCATTGTTTGTCATGCGGTAGCTGAACGTTTACACTTCTGGACGGCTGAGATCGCATTACCACTGGCACAGCTTGCACTGCATTCGAAGGCGAC
AGTTCCTCCCGTTGCAAACTCCCACTGGAGGATCAACTTCTCGCGCGTCGAGTGGCCTGTTCGAGTCGTCACAGATAGTAGTGGGAAGCAACACTATGTG
AAGGAACTGGGCTTGAATGAAGAGAACTGGGTGTGGAGTTCGCAGTACGCAGTGGATATGCATCGGCCCGAGTGGTGGGGATACCTTCAGTTTCGTCCGC
AAAGAAAGACACCTCCTAGGTCGACCGACACGAACGAGATTGTGCCGCTGGACCTAGAGTGGGGAGTGCGCTACGTGAGTTTCCAGTTCTATTACGCTCA
GCATGACTTCCACAAAACGATGGGGGAATACGCGTTGACCATGGACAAATTGCGTTCGTTCTTCTCTTCGCCTGAAGCTTTCCAATGTAGCGTGTTGTTT
GACATTCATGCCACGAAGGAATCGTTTCACGCACGGATTGGCCTAAAGAACGACACTAGTGACAACATGGATGCCGATGGATTCGTTGCGACTATCGAGG
ACGACGGCCACATAGTTGTGGAGAAAATGCACCGCAcgtctgcagttgctgctaTCAAGTGA