Transcript Name :
Phyke_g178
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5290.74225
InsideOutsideTMhelix
626-1074
1-602
1098-1189
603-625
1075-1097
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4868 bases(100 bases per row)
ATGGTGCGCGTAATCGCAGGATCCCCAGCGCTTCTAGCCGCTGTAATGGCGCTCACAGCGTTGCTAGAGGCACAGCAGACAGTAGGCTTGACGATGGAGC
TTCACCGCCTTCCAGAGCACAATATTCACCCCGAAAAGTACTCGCGTCGCCTCAATACCGAAGACGACGGACCGGAGATAGTCCCGCTGCATATTGGCCT
CGGGTGCGTTGTTTTAGGTAtttattttgttgttttAGGTATAAAATAAGAGAATCTAACGTATTTGTTGATGGAATAGGACCCATTATACGTGGGTGTA
TGCCGGAACGCCGCCCCAGCGAGCATCGGTGATTGCAGACACCGGCAGTGGGATCATGGCCTTCCCGTGCTCGGGATGCAATGGCTGTGGCAACCACACT
GACCAGCCTTTTAAGGCAAGCAATTCGTCCACTTTGGTGCATGTGACATGCTCCAGCGACTCGTTCTTTCAGTGCAAGGAGTGCAAGTTGAATTCAGACA
CGTGCGGCATCTCCCAGTCGTACATGGAAGGAAGTAGCTGGAAGGCGTCAGTGGTTGAGGACGTGGTGTATTTGGGTGGCGATTCGAGTTTTACAGATGA
CATGATGCGCAACCAATATGGGACGCACTTTCAATTCGGATGTCAAAGCTCGGAGACGGGGTTATTTGTAACTCAGGTGGCTGATGGAATCATGGGGCTG
TCCAACACGAACAACCACATTGTGGCAAAACTGTATCGCGAGAACAAGATCTCCAATAATCTCTTTTCGCTGTGTTTTGCGGAGAAGGGCGGCACCATGT
CGGTTGGCGACCCGAACACGCTCGCTCACCGGGGTGAAATTACCTACGCAAAGATCATTACTGACCGTTCTAATGGGTAAGACGAGTGTGTGTTGAATTG
CTTTGTATCTCACATTTGTACTCATGGCAATGGTGTGTGTCCACTTAATGCTGCAGACATTTCTACAGCGTGCAGATGAAAGACATTCGCATTGGTGGCA
AGTCCATCAAAGCCGAGGAAACGGCATACACGCGCGGCCATTACATCGTCGACAGCGGCACTACAGACTCATATTTGCCGCGTGCTGTGAAGACCGAGTT
TTTGCAGGTTTTTAAAGAAGTCTCAGGTCGCGAGTACCAGGCAGGGTCGATATGTACTGCTTTCACGAAGGACGAGATAAAATCGTTGCCGACCCTCCAA
TACGTGATGGAGGCCtatggagaagaaggcggtgAAATTATCTTGGAAGTGCCACCTGAGCAGTATTTGCTGAGTACAAACAATGGGAATTCCTTTTGCG
GAGGTATTCACTTGTCAGAGAACTCGGGTGGCGTCATTGGCGCTAACATCATGACGGACCGCGACGTGATCTTCGACCTCGGTAACCAGCGTGTGGGTTT
TGTAGATGCAGACTGTATGTACCAGGCTTCTATGGATGCTAGGAtgtcgccaacagcaactcctgcaagcaatggcaacaacaccagTTCGGAGAGCAAG
GAGAATAACCTTGTGCCTACGAAaacgactgctgcagtacCAAGTGCTATACCTGGTGCAGCTACTACCGTCGTACCGACTGCGGCTCCAACTCCAGAGG
CAACACCGGTTTCTACTCCAGGCgcaactgctgctccaactccaggcgcgactgctgctccaactccAGAGGCGACTGCTGCTCTAACTCCTGCGACAAC
TACCGCTCCGACACCAGAGGCGACAGTTGCAGTAACCCCAGAGCCCACGTCAGTCACAACGAAAGCAGAGTCAACCGCTACTTCAAAATCTCAAGCGACA
GACGCGTCGACTGCAGAGTCCATGTCTAcagaagcagcttcaaatCAAACTCTGTCACCGCTCTCGCAAGACGCGCGGTCTCCGGGCACTcagtcgtctt
catcatctgctaCTGACATCTCGACCAATACCAAGGGAGGAGGTTCAGGAGGCGCCCATCCAATGGTGTTGACAATAGTGGGTGCGGTTTTGGTCGTAGG
TTTcttgctgatgatgctgattTCTGTCAGTCGTCGGAGACAGAACGCTGGCAAGGAGGCGCTTTGGAGCCGTGTGAAGGGcagcgaggaggacgaggat
gacgacgacgaggaggagttCGGACTAGTTCgcaaggaaaagaaggttTCTTCGAAGCACCAGCGGCTCgaaatggaggaagaagacgacgacgatgacc
TCCACGGTcaggacagcagcagcgacgaagaagacgaggttTTCGACCGGAAAAACCTTCAGCACGACGAGTCAAAGGTGGACCCTCGCACACTTGAGCG
GCTGTGAAGTAGTGCAGGGCGGAGCACTGATATACCGGATTCAACATCAAGTTAAACAAATACATGTGTGCTGGCGACTGATAGATGAAAGTTGAGAGTT
AGCATGTACACTTAGatacatgtagccatctcgTTGCAGTTCAGTATCCGTTATCAAGAAGCCAGACAATTCCAAACTTCAAATATTtctctgattggct
gattACTTACATTTTAACAATAGATATTTGTTCTTATTGGCTATAAATAGAATTACCGAAATATTGCATTTCAGTTTTTAGTAGCTCTCCCTGAACAAGC
ATGATCAAGGCTCGAACGATGGCATCTGCACCTCGGTGGCGAGCTGCTCTCACTACTTTCGTAGCTGTAGTGTGCGCATACAGTCACTCACCTTCACTTG
TAGATGGAGAGCAGAATTTCCTGAAAATTCCTCTTCAGAAACTGCAGTATTCAGGTGAAGATGTCGCCCTTCGATTGACAAAACAACAGGCTCGAGTGCG
ACGAAGAACGCAGGAGGCGGTTAGCAACAGTGATGGGGACTTTGCATTGGGGGCGGTAGCTCTAAGTGAGGCGCCGCTTGGTGTTGGATACGGGTGCGTG
GATTGGCAGATATACAGCGGCATGGATGCACTACTTGACagtgtgttgtgtgtgtgtgtggtcTGATGCAGCACTCACTACGCAGAAATTTACTTGGGAA
TCCCAGCGCAAAGAGCGTCAGTGATCGTGGATACAGGAAGTCACTTTACAGCATTGCCATGCAGTAGTTGCAACGGTTGTGGCACACACACAGACCCTCT
GTTTGACATGGCCAAGTCGACGACCGCTAAATACTTGGCTTGTCATGACTTTGACTCTTGCAATTCGTGCCAGGAAGATCGCTGCTATATTTCTCAGGTT
TGTTTGTGATTGTACTTCATTGATTGTTAAATACGTTCTAATTGACTGAGTTGTGTTTGCTGAGCAGAGGTACATGGAAGGTAGCATGTGGCaggctgtt
gttgtggatGAGCTGGTGTGGGTGGGAGGGTTTTCCTCGCGGAGTGATGAAATTGAGGGAGTGCTCAAGACGTTTGGGTTTCGCTTCCCTGTGGGATGTC
AGACGAAAGAGACTGGTCTCTTCATCACACAAAAGGAGAATGGAATCATGGGCCTAGGGCGTCATCGGTCGACAGTCATGGCATACATGCTGAGTGCAGG
CCGCGTGACTCAGAATCTCTTCACGCTATGCTTTGCAGGCGATGGTGGCGAAGTTGTGTTTGGAGGCGTAGATTATGGTCATCACACAAGTGATGTGGGC
TACACCCCGCTACTCGACGATAACTCAGCATTCTATCCGGTTCACGTGAAAAGACTCGGGGTGAATGGTGCGCCTCTAGACATCGACGAGAGCACACTCA
ATTCGGGTAGAGGTATAATTGTAGACAGCGGCACAACCGACACGTTCTTCGATGCGAAAGGCAAGCgcagcttcatgaaggcATTCAAGGAGGCAGCAGG
TCGCGAGTATAGCGAGAGTCGCATGGAGATTTCTGAAGATGAACTAGCGGCACTCCCTGTAATTTCCGTTGTGCTGAGTGGAATGAGTGGAAATGGCAGT
GACGATGTCCAACTGGATATCCCGGCGTCGAAATACCTTACCCCCGACAACAACGGGTATTACTACGGTAACTTCCATTTTTCCGAGCGTAGCGGTGGTG
GTAAGATGCGCCAAAtcgtttctgctgttgtggtgcCTGCCTAACGTGTGCTTATTTCTCGGTATACACAGTATTGGGTGCGAGTACCATGCTTGGCTAC
GATGTGATCTTTGATATGGAGCACAAACGTGTTGGCTTTGCTGAATCAAACTGTGGTACGGCAGCGTAATCTGCCCTATAACCCTACTTAGATTGTTTTA
TCTCATGCAGTGATTCGTTTGCTTCGGTTTATGCAGGAAAGGGTTACGCCAACAGAAGTAGTAGTGATGTGGCAGGTACTGACCAGACAGCACCCACAGA
TACCCCCACGGCCAGCTCTGGCAACAATTCTGTCGCTACACCAAACGAAACTTCATCTACAACTGGATCCAATgcgacaacaacgacaatTGGATCGAAT
GCAACCGTAACGACAGACGGATCCAACACGACAGCAACGGCATTTGCTGGTGCAGTAGATAGTACGGCCAGAAACAGTGGGCCAGCATTAGGCGCTTCAA
CAAAGCAGTCAAATCCAGCGATCGGTGCCTTCATCGCGGAGGGCATTATCATCTCGCTGGTGGGCATTGCGCTGGCTGTCGTGGTTTGGACGAGGTGGCG
CACCCGTTCATGGTCTCGCATCCCTGAAATGACCCCAACTCCTCGTGCACACACACAAGGGAGGAGAGACGACGATGCTACAGGAACTTTGTCTTCCCCT
TCTCGAGAGCTTGTGCTGTCGCCGCGGTCCCGAGCAAGACAAGCATCCCCTAAGTTCACGATCGGTTCgagtggagaagaagatctgGGAGGAGACGAAC
TGCGCATAGAAACCGAGGCAGATAGCAGTCCAAGTGTCCGGACACAAGGAGAACGAACCCAGCTCTAA