Transcript Name :
Phyke_g159
Orientation:
(-)
Number of Exons:
10
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WW domain13.752PS50020
WW domain13.26PS50020
HmmSmart predictionP-Valprediction_id
WW domain8SM00456
WW domain1.6SM00456
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-871
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4191 bases(100 bases per row)
ATGCCGCCCAAGTCTGCAGTCGCCGCAGAGCggctcaagaaggagctaACAGCTCAACAAGCGCGTGCTGAAGCTCTCAAGCATCTCCAATCCACAGGTA
GCGGTCCCAGTCAACGTGAACTcgcacaacagcaacaacttcgtcAGCGCCAGACAACTAATGCGACGTCAGCCACTGCCCAACGCCGTGTCATCGGCTC
GCAACCAACTGCCACAGCGGCCGACAAATTCGACCCAAGAATCAGAGACAATACACTGCATGCTGTGGCATTACGTCGTGcccaagagctgcagaagacg
cagcagataGAACAGATGACAGAGAGTTATCACATTGATTCGAGGTCGACAAAAAAACTGGCCCTCCCGTTAggatggcaagaagctgttgatcCAGCCT
CCGGAGACGTTTACTACTGGAATGAGGTAAGGAAATAATATATTTAGAGAGTAGAGAGAGTAGTAAGAAGGCTAATCGTGATTTCTGTGGTGATTTTATG
GTGCAGAACACCCAGGAGACGGTGTGGGAGCGACCAGGAGCGTCAAAGCAGGTCAGAAAACTCCATTTCTGTGGGTTTGATAGGGAAATTATTGTCTAAG
AGACTGATGAATGTCTGTGgttgatggtggtgctatTGTAAAATCAGGTAGTTGAGAAAGCTGATGACAAGACTCCTCCTGAAGGGCAGTTGGAAGAGTA
CGTGAAACAAACAGTAGGTTGTGTCGGGTTTGAGATGTTAGTTGACGGTGATATGTGGGTTTTGAACTTaatggtgcagtggttgGGAAGAGGTACCTGA
AGCAGCGAGTGGTGATGTTTACTACTGGAATCGGAAAACGAACGagacgacgtggacgagaCCGGCAGCTCGGAGCGTGTCGTTAGGTAGGAATCTGTAT
GTAGCTGGATGCGAAAATGTAGCTGTTCTAATGTCTATTtgattgttgttgcagcacaaGCATTAGAGGCGAAGGCTAAGCTGGACGGGATTCTGAAAGG
CTGCGGAAACACTTCAACCAAGACGAGTGCAAACGTGAGACCAGACGCCAAAACGAGTATTGTGCAAAGCTCCTCGTTGCAGCGCTCTTACCCAGCAGCA
TCCGCTGCAGCTAGTTCGGGGCACAAGAAGCGTTCCCAGAGCAGTACCGATAACACtaacaagaagcacaaacgATCTGGCCCCAGCGATGGAGCTATCG
ATCCTATGGATCCGACTGGTTCAGGAGGGAAGTGGTCTGACGGCCTTGTTGAACAGGGTGATCAGTACGCAGACTCAACCGCAACTGGACCATTGTACCA
ATAGCGTCCATACCCAGCCCCGGGTCAAGTACTACGGAAAGAATCTGGCCGCAAATGAACCTGAACTAACTTCTCAGCAAGGAAGGAAGTGGGGTTGGAA
ATACTGCTGCGTGGCAACAGAATGAGTCGTCAAGCTATCATTGCCATGATCACACCCAAATAACACCACATCCTTTAAGCGAGACATCGACACCAGTATT
TTTGTTGGATGCTTTAAATACTTCGCTCTGAGCAGGACATCGAGTGCTTTGGACActcactctgctgctgtgatcATTGCCCACAACGTCAAAGATGATG
GAAAGCAATTTCAGACGACGGACATCTGGTGGGAAACTTGGAAGCAGTGGTGTGATGAAGAGCTGTTTGAGCCCCAAGGGTACCATCAAAAAGAGCAAGC
AAGGCCGCAAGGcaaaagagcagcaagtacaAGAAATCAGCAATCTGAACTTGTTAATCGGTCGTTTAGAAGATCGAGACACTCAGCGGCAAGCGTTTGC
AAAACTCATGTGAGAAATCTCAGCGTGGTGATTGACACTTGCGTTGAAAGCAGGCTGGCACGTTTCTAACTACCTAACTCTTGCCGTAGTGAATCCCTAC
CGGATCTTGATCCACCTCTTGTGAAGGAAGTCTATGCGCTGATTGAGAAAAACAAGGTACGTGTTTCGTAGCGGATGAATCTTTTTTTTGTATGTTTACA
TTGTATCGTGCTGCTTAAAGAAACCTGCGCGGGCGTCAACTCGACGTATGCTCGTTCTTCTGATAGCCGCGATCTGCAAGTGCCACCCCATTCAAACAGC
CAAATTTCTGCCTCGGGTCCTAGCTTACTTATGTCTACGACTTCGTGACAAGCAGACTAAGACGACGGATGGTTGTGTAATATTGGCGTCAGCTATTGCA
CTATACGTTATGCCATGCCCCAATGTATCCCTCCCCGCAGGCCAATTCGGATCCCCGCGACGACTTGGTGTGAATAGCATTGATCAATCCTTCAGGGCAG
TAGCTGCCGTGTTTGCAAAGGAAGTAAATGCAGTGGGTGaggcagcaacgagatgtCTCTGTGGATTGCTCCGCCCCATTGATTTTGATGGCGTGTCGGT
GCCTGGTCCCAGTACAATACTGGCTCACGCCGCACGCATTCGTCCATTCTTCAAGACTCTCCTAGCCGATACCGTTACGAAGATGGATGGTAGCGAAATG
TTTGCGAGCTTCTCACCTCTGTTTCTCCTGCTGATATCAGCTATTCAGTTAGCGAAAGATGCTTATGAGAAAGCGTCTTTTACTCCATTGGGCGACGACT
TTGCACCGTATATCGCCTCCATCTATGAGGCGATTGAGGATGTCTTCCAGTTCACCCCTCGTGAGGACTGGGTGGTACGGAAGCGTGGGCTAGAGCTATT
AACGGTTCTACTCGACACATTCGTGCTGCAAGATTGTGCTTGGTGTACCTCCATCGAGACAGCAAAAGAGTACTTTCAATCCACTTTGGTACGTTGTCAC
CTTTCTCACGGACAGCAGTCAAAGACTCACCAGTGTTGCATTCATAGGAAAAGGTTCGGACGCTCGTGCTAGCTGGTCGACACGACTCAGTCTCTCTTGT
CCGAGAAGCTGCTATACCCGCTGCGATGGCATTTGAATGTCTGGAGAAACAGTGTCCGCAAGCAGTATATGACATTCGGTCAAACATCATTGAATCACCT
GGCACAGGTTACGACTTTGTTCCACCCAACCCTCCGGGCTACACGTTCAATGACAGGCGAATAGCTGTCAACGACATTCGAAAGGCTGGCATCTCCTCGG
AAAGTGGTGTCAGCTCTCAATCGATTCCGTTGTCAGTGGAAGAGGATAAACTACCTGACTTCAGTGATTTCACGACAGGAGACGAAGCGCTACCGACAGA
GGATATTTCTCCACAAGGGGATGACACTACCGCAGCTATCAGCAGTAGCAAACTGACGGAGATAGGCCGTGTTAAATCTACTAGAGGCGTCAGGGCAGTA
TCAGCAGAAGTTTTGCCTCAAACTTCTGATCTTactgaagatgacgagaaATTCATGGATTTGGTCATGGATCAGGCAGCTGCACCGGACGATGAGAttg
aacaagaagagcaccTACGACTCGAAGacgccagaagcagcaatggtgatGCCAAGGTGAATAACGCGGGGACAAAATGGTCGGGTGCTTGGAACGTTGC
TCCCACGCTTCCAGttgcaacaacagcaaaaaagCCAAAACGTCCACCTTCATCGATAACGACAGCCATGCAAGCAGTCTCAGATGTAACGCAGTTCGTC
GCGAAGCAACGAGCAAAAACCCGTTCTCGACACGCTTACCAAGATGTTCCTCAGATCTCCCTTCCAAAGCGAGGGCCATCTCGTCATATTGACATACCTG
TAGttgaccacgacgatgaTCGGAGCGCTCAACCTAATTACCACAGCAATCAAaatgacgatggcgacacTGACAATGGGGTCTCGGATGGCAACTTGGA
GATGACTCGTGCAGATGCCGCTTTCCAGGCAGCTCAATGTGGTGAACACGAACTGGCAATCCGTTTGTGTATTCTCGAAGATGACTCGGAGCTACTACGG
CGTACATTGACAATAGTAGGCCCCCCAGCCATGACATCGTTGTCGATTGCGGCGCGTAACGCGCTGTGTACAGCATTTCTGTCCCTCCTCGATGGAGATG
CATCCGACGTATGGCTCGTGCTTCAGTGGCTACAGCATTGGGCTAATGAGATGGGGCACAGCCAACGACAGTTCGATCAACTAGATTCGCGTGTTATACA
GGTGCTCGGTGAAAGGCTCCGTGAGATGGCAATGGCACCAACGAAGGCGGCGCTAGTAGCAGCTCACGTGATGTTTTTGCTGAGGTTATAA