Transcript Name :
Phyke_g171
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_466812
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
MSP domain20.198PS50202
MSP domain15.696PS50202
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-590
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
structural molecule activityGO:0005198IEA
*** None ***
*** None ***
Sequence
        1773 bases(100 bases per row)
ATGATCACCGCGTCCGTAGGTGCCGACtcaagtctgctgctggagcctGCTCGggagctgctgttcccaTTACCAGACACCGCCACGTCGCGCTCGCGCT
GCTGCCTCACTCTTACGAACCTGTCGCCATGCAACGATGTCGTTTTTCGTGTACGCACTCGCAACCCTGATGGTTTCACTGTACGACCGACGCACGGACT
GATAGCGCCTGGAACGAGCTCCCAAGTGATTCTTTCAGCTACAACGAGGACCTGCGAGCGTCTGAGTGCAATGGACCCAAGAGATCTGATGACTCGCCAG
TCGTCTGAGCTGTTCCTTGTGCAGAGTGTGGAgagagaggaagaagtgcgGAGTATGGAACCTTTAGATTTGACTTTAGACCCGACATCCAGCTCATCGC
TACGGGCTTACTGGAAGACGATGCCTAAGGATTACATCGCAGAGAGCAAGATGGTGTGTCGGTTCACAAAGTCGGAGGCAGCACCTCCTTTGGGCTATAC
TACAGACGAGAATTTGTTGTCAAAAAGTAGCAGCGGAAGTGCAAGCTCAAGGGAGTTCAGGTCTAGTCGTAGTGGAAGCAACAGCCGATTTacgctggaa
gaggagaCGACAATACGAGAACAACGACGCAGTCGTGACCAGTCCTTCCGAACGACGAACGACTCGTTTGCTAGTGACGCTAGCTTCCACACGACTATAG
AGGCCCCTGTGATGGAGAGAGCGTCAGATGCCAGGATGTCAGCTGCATCCAGTCGGGCTTCTTTAGCTAGGACTCCACCGGAAAGGGAACCAATGGTGAG
TGAGAGGCCACGAGATACCGTGCTGACAAGCATCACTGTGAACGATAGCGCGGTCAGCGACACCATGGTATCTGCAGAGATGTCACTGCCAACGGACACG
ACATCCGGAGAAGCAACGCACGAGCTCGGTCCACTGCTCTACCATATTCAGCCAGAAGATGTGCTTTCCTTTGATGTGAAGCCTGCGCCACGCTTCTGGG
GTAGCAGCTCGTTGTTCGTGGTGAACTCCAGCCAGAACGACTGCTTAGTTTTCAAAGTGCGCACGTCCAACCAGTCAGCGTATACGGTGAAACCCAGTCG
TGGCCTTGTGTCAACTACAAACGCGCACAAAGTTGTGGTTTCGCTCTGTGCACCCCACGAAGGAAAATCTTTTGATGTAGCAAAGCGTGAAGCCAAGGAT
GGATTTCTCATTGAAGTTGTCAACATCTCGCGGGAGAAGTACGCTAATCTGATAAAGTTGGACGAACGCAAACGTACTCGCGAAATTGGTTCGCTGTGGT
CCCTCCTGTCACCAAACGATCGTCAGTCGACGATGCTCTCGGTCGAgctcaagatggaggagagtgaTACCAGTAGAAGCAGCGGCACTCAAGCAAGTTC
AGGTAGTGCGGAGTCGGATGCCCAGAGCAGAACCAGCGCTGGAACATCGAAACGTGCATCTGAAGAAGCCTCCAGACAAAGGTTAGCATCCGTCGTCCAC
GGATTGAAGAAACTGCCAACAGACAATACACCTGAGGGACCAGAGGTAACCAACGATAGTCCAGAGATGGTCAACCGTCACTATGCTTATTCGGATTCGG
ATGAGTCAGCATTCACTATCGCTCCAACCGTTTTGgaaactgaagatggcaacaggaacagcgacgacagcggaGAAGTGGTGTTCCCACGACGTTCTGC
CGTGGTCATCGTCTCCGCTGACAGGATGGACACCGTCGACTTCTCGAATCCAAAGCTCTCCTTCTTTATTTAG