Transcript Name :
Phyke_g141
Orientation:
(+)
Number of Exons:
4
Description :
ATP-dependent protease hslV
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Proteasome B-type subunit55.685PS51476
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-227
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        949 bases(100 bases per row)
ATGCTTGCTCGCTCGCTGTTCCGTGCCGCTTCTGGCGCCTCCAAGACGCCATCGATggccgctgccgccgccaaCTTTGGGGCGATGCAGACTACAAACT
TCTCCGATGCTCCTACTGTAATAAAATTCACCCATTCGGTTGTTTTAATTGCAATTTTAACGTAAAACCCTGACATTTATGCTATATTTTCTGGTACTTT
TAACTTTAGATGCATGGCACGACGATTCTGTGCGTCCGCAAGAACGGCAAAGTGGTGCGCCTGATATAACTATTAATTATGCGTTGCATGAGCTATTGGG
GCTGATCTGAGGTGCTCTGGTTGTGATGCTACGACAGTGTCTGATCGGAGACGGGCAGGTGTCGCTGGGCCATACTGTGGTCAAGCCTAACGCCAAGAAG
GTGCGCCGTATCGGCGAGAATATCGTGGCGGGCTTTGCTGGCTCCACAGCAGATGCCTTCACGCTCATGGAACGCCTGGAggccaagctggacgagtACC
CGGGACAACTCACGCGCTCCTGTGTGGAGCTCGCCAAGGCCTGGCGGACGGAAAAATACCTGCGCAATCTGGAGGCCATTCTGATTGTGTCGGATGCCAA
GCAGTCGTACACACTGACTGGAAACGGCGACGTGCTGGAGCCGGTTGACGGCATTATCGGAATCGGCTCGGGAGGCACCTACGCCCTCGGTGCGTTCTAG
GCTTGCTGGGGTCCGGTGATGTTCTGAGATGACTAATAACGGGGCTTGTactttgttgttgctgttgctgatgttgtagctgctgcgCGGGCACTGATTG
ACCAGCCGGATCTGGACGCGGAGACGATTGCACGCAAATCCATGAAGATTGCGGCTGACATTTGTGTCTACACGAACGGGAACGTTGTTGtcgagatgct
ggaagaagaggggAAGAAGCTTGAGGCTGAGAGCGAGCAGAAGGAGTAA