Transcript Name :
Phyke_g150
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_284561
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-4
65-113
28-41
5-27
42-64
NN-scoreoddsWeighted Score
0.7933.5970.007
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
*** None ***
Sequence
        666 bases(100 bases per row)
ATGAGCGGGGGATGTACGTGTCCCTCCGTGAAGCTTTACTGCTCGTCTCTCTCTGTAGAATATACTCAGCCGTTATCTCACCTCCCCACTTGTATATTCT
TCTTCACTATCTGCAGGTTATTTGTTCGGCCTGATCCTCAGCTTCTCAGGCTTCGTCTTCCTGGTCAGTCTCAACCAATTTCCACCTTATACTAAAAAAC
AACTACACTGATATGCttattatttatttttgATTGCTACTGTTATACAGGTGGTCGTGGGCTGCTTGCTGAAGATACAGCCTCTATACATTCATAACGC
CAAGTCGCCGAACTCTGGAGCGAACGCCTGCTTCGAAGCCGGTGCGTCCTGCAGACATCCATACTGCCTACCTCTtgattgctgctgcggtTTAGGGATT
GAGTGGGGACTGACTTGTGCGTGGTTATtttgtatgtgtgtgtgtatttTGTGGTTTTGGTGGCGCTGTTTGCAGCAATGCTCTATGCAGTTGTAATGGG
TGTGTGCTACGTCTACTGGCGGAAAGAGAAGCTGCGTGCTGGCGAATTGGACTTCCTGTCCGACTCGTTCACGCTCAAGCGGGACAAGATGTACTACGGC
TCTGAAGACTCAGACGAGGAGTTGCCGCTGGCCAAAAACATGTCTCCCACGCCACGGATGGTTTAA