Transcript Name :
Phyke_g147
Orientation:
(-)
Number of Exons:
13
Description :
putative RNA helicase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin domain14.6PS50053
RNA helicase, DEAD-box type, Q motif10.345PS51195
Helicase, superfamily 1/2, ATP-binding domain29.585PS51192
Helicase, C-terminal24.944PS51194
HmmSmart predictionP-Valprediction_id
Ubiquitin domain2.8SM00213
Helicase, superfamily 1/2, ATP-binding domain1.4SM00487
Helicase, C-terminal1.8SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
RNA helicase, DEAD-box type, Q motifIPR014014
*** None ***
InsideOutsideTMhelix
1-229
250-1180
230-249
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
KO ID
K12823
K12823
K12823
*** None ***
Sequence
        5577 bases(100 bases per row)
ATGATGGAACCAGAGAACATCACAGAGGAGAAGCCTCTTGTACGGTCTCCCTTTCAGTGTTTTTTCTTACTGCAATAATTTCCTTAATAACCTTTTTTCT
TTGCGTTTCTTTTGCCAGCTCTCGGAAGAGTCGGTAGGCATCACAATTAATGATGACAACAACGCCAAGATCCTGCTAAAAATCAAGACGCTGAGCGAAA
AGCCGCTACATCTGGAGATTGTGCCGTCCGCTTCCGTGGCGGAGTTGAAGGAcctcgtgaagaagaaagcgaacGCTGAGGGCAAATTTCTGCGGCTGAT
CCACCAGGGCAAGATGCTCTCGGACGACAAGGCGACACTGGAGAGTTGCAAGGTGAAGAACGAAGATTTTATCCACTGCGCCATCAGTTCTGCTCCTCCC
AAGACTGTTGTTAACCAGGTATTTAGATTGGAAAATGGAGATGTTTGCTGTAGTGTTAGATCTAACGTTTTTTGGAATGTGTTTTTAGATAACTGCGGCA
ACTGATAGTGACCCAGAAGACAGAGATGATCCGGCGATGAGACGAGGATTTGACCGTCTCCGGGATCGTTTAAGCAGGGAAGAGATTCAAGCGCTGCGCT
TGTACTTCTACCCACAGCTCTCGGTGTATATCAGCCAGGCCGATCGTGTTCCTGGAGAGTCCAGTGAAGACCGGATATACCGTCTGGAAGAAGAGTGGAT
GGCGTCACAAGGACCACAATCGGAATTCGGTATGCGTCTTTACGGATTCTTTAATCCTTCtttttttgttgttgcttaAACTGACACTTGGATCGTTTCT
TGCTTGCAGCGCTGAATGTTGTGCCGACGGCTCGGATCGCGTTGGATACACAGATTGACATGAACGGCATGAACAACTCGATTTTGGCTGCAGATAACGA
AGGCACTGGCACTGAATTTCTGTGGGGGTTTCTGATGGGACTCCTGCTTGGTGTATTTATGCTACTTATGGTACGGTTGCCCGTGGTTGTTTCAGTCCAA
ATTGATCTTGTGGCTAACTAtctgtttctgctgttgcatcaccagcttcttgacCGGTCGGTTCCTCGCAAGCAAAAGGTCggcctgctgcttggcgttA
GCATGAATTTTTTCTTGAGTGTCGTGCCGCGTGCTGTCTCTGACCAATAGAGCACCGCTGCCAGCTACGCTCGCGCGTGCACAAAGGCTctttcgagctg
ctggcatGCATCGTTATATATATTCCTAGCCTTGTACTGTCCTCGCCTTATCAAGTGTTAAGCATCCTGTCCACAACGCTCCATTGGTCCAATATTAGAC
GCAGGTTCGAGTTAGACGCTGGTTCGTGTCCACATGAACTTCAATTTCGCAAAGGATTGGTCGAAAAGCACAGTGCTTTTCGACCAATGAAAATTTCGTA
TTCTCTCCTTTACAGCCAACCAAAATCTCTGCCGTGAGGTATCAGTGCATCCAGTGCttctcatctgcagcaagttCATGCCGGCCCTGGAGGAGAACAA
TCAACAGATCACCGCCGCTCAACCAGACCAGAGCGCCATCTCTCAAGTGCAGTCGACCGACGGACAGACGGACGACAGACACCCAAAGAGACGCAAGCGC
AACTCCACCGGATCGAACAACGGAATGGGAAAGGAGCTCACTCTGGAACAGAAAGCCATCGTTAAAAACTACGTTACTCGCACCATCGCTGAAGGAGCCG
TCAAGTGCAGCTACTGCAACAAAGAAATCTCGTCCCGTAACATTGATCGCTGGGCTTCACATCTGCGCGGTTGTGCTAAGACCCCCGACGATATCAAGAC
CCAGATCCAGCCCTTTCGAGGAAATTCGCCCCCGCCTGCTGAGGACCCTGTTCGTGTCATCCAACCACCAGTGAAGACACTGGACTTATCTGGTGGACAT
ACACCTACTGCTGGAATCGTGATGCCTATCGCCCCCtctaccaccaccactcaTTTGAGTGCACCTTCGGTCAACCCAATGGGCACTTGCTACAATGAAG
TGTTCAAGGTGCACGTGTCGAAAGACTATATGAAATTCAATGCCGCGCACTTTATCGCTTACAAGGTGAGACACCAGTTAACTCTTACAAGGCAGCTGAT
ATTGAATGACCTTCTTAACATGGTGTGGATTTGGGGATGCTGCAGGGCTTCCGGGAGAAATTGCACGGTCACAACTACCGCTTGGCGGTCACGATCACTG
GACAGGTTGGACCGGATGGTTATGTGGTGGATTTTGGTGAGATTAAGAAGATCTCACGGGTTATCTGCAAAGACCTGAACGAGTCGTTCCTCGTGCCTAT
GAACAGCGATGCGCTGAAGGTGCGCAGCTAACTAATTCTGATTGAGTGGATGTGTACATTTTGGCATGTTGATTTGAGCTCTAACCATTCTTACGGTTGT
ACTTGTGTGCTGCAGATTTCCTTTGATGAGACCAATGTGCATATTCTCACTGAAGATATGGCGAAGTTTAGGTTCGAAGATCGACGCTATTGTTGCATAG
GTAACAAACAGGAGGATTCTAACCAGGACTATGTGTTTGTTATGCCATGCACTCTAGCTTTCCAAAGGCAGACTGTTCGCTGTTGCCGATTGTGCACTCG
TCCGCTGAAGAGCTGGCCATCTACATTGTACGTGCACTGTTGCTAGCTTCCAGTCGCATACCTACACTTGCTCACTCAAGTTTGTTTCACTGCAATTGAA
CAGAGCAACCAACTCATCGACGCATTCACGATGGTCGCACTCCTGGTAAGCAAACGTTCCTCTACATCACTTCCACATTACTCGAACCTAGACAGCTAAC
AGTGTGATGGCAATTACAGGAGCGTGGCGCGCGGAAGATAGAAGTGAGCATCTCGGAGGCCAACCAGCAGTTTGCTTCGTACGAGCGAACCATCATGGCG
TAAGGCAGAAGCGGTTGCCAAGCTAGTATACCCATGAAGACGAAAGACCGGGCCTGATCACCAACGGTTAAACACGCTCCTCCGTTTTTCTGCGTGCAGC
TTTTCCCCGCAGTCCAACGTTTAACATGACAATTGATGTTTACTGTAAATTCATGCTTAATGCCCCCTCATCCGTTTCGTCCAATCGTTCCGGATCTTTT
CGATTTTCAACGAATCGTGAAGAATATTTGGCCGTTGCGACATCTGATTGCTGGAAATTCGCCAGCCAACCAGACCAAAGCGATCTCTCCCGACCCTTTC
TTCAGTCATTTGCGGAAACGACCAGGAGTGCGCAGTAGGAAACCAAGACACCATCACTCTTTGAATCATGTACAGCGGCGGCGGTGATCGATACGGCgac
tcttcttcacgtcgTGACTACGGCGGATCTTCCTAcagcggcggcggcggcggcggtggcggtggcggttACTCTTCccgtggaggtggcggtggctatg
gaggcggcggcggcggcggcggcggcggctacggtggtggcggcggtggctacagcggaggtggcggctacggtggaggcggcggtggcggccgtggagg
aggcggaTTTGGTGGCAATGGAGACCTTGGATCCAACCTGGACACACACATCCAGTGGGACATGTCGAAACTCCCAGTGTTTGAGAAGAACTTCTACTAT
GAGCACCCGGACGTGACCCGTCGCTCGGAGGAGGAGTACGATAACTGGAAGCGTGAAAACCAGATCATTGTGTCCGGAAAGGGTGTTCCTAAGTGTGTGC
TGTCGTTCGAGGAGGCTTCGTTCCCGGAGTACGTACTGGAGGAAGTGGTGCGTCTGGGCTTTGACAAGCCTACGGCCATTCAGTGTCAGGGCTGGCCCAT
GGCGCTTTCTGGACGTGATATGGTCGGCATTTCAGCGACGGGATCAGGCAAAACGCTGGCTTTCTTGCTGCCCGCTATCGTGCACATTAACGCACAGGTT
CGTAGTGTGAAGCAGGCGCTTTACCGAGCATATATAGGCtcttttttgttgttggGCGACTGGTCCACAGCGCTGATGCGCTGATGGGGATAGCAAAGTT
GTGTCTGCACACGACGTTCGTTCATGCATTTGAATGCGATGAGCGATTCACACGCGTTAGGCGTGGGGATTTGAACGGTCTTCGGGACGTGGCCGATTCA
CGTGGATGTACGTTTGTGAGGGACAGTTGATGGTCCTTCGGTGAGCGGCATTCGCGTGCACTCTGTCACATCTGTTGATTCGTCGCGGTTTAGCTGTGTT
GAAGTGCCGGTCAAGTTGATGGAGCTTGCTCAAGGGTGCGTGGCGCTTTGCTCCGTGCGTCGCGTATTTAAAGGCGAGGACTCCTCTATCAACCATCCTG
ACAGACTGGTCTGGCACGACCGACATGTGTacagctgcttcttgttttCTTGCCGACCACCCGCGTACTCCTGGCAATTGATCGGTGCGATATCTGCATT
GGTGCGTGGACggtgacaagaagaaagagcagCATGCGAACACCTCAAATCCCTCGGCGCTCGCTTGTGTTTGCTTTCTCGAGCAGCTTTTGTGCCCCCT
GGTAGAGTGTAGTGTGAGCTAACATATTGTGTTTTGCTATGTTGTTTCATACAGCCGTACCTGCAACCTGGAGATGGTCCGATTGTGTTGATGATCGCCC
CGACGCGTGAACTGGCTGTGCAGATTCAGCAGGAGTGTAACAAATTTGGCGCTAGctccaagatcaagaacacaTGTGTGTATGGCGGTGTGCCCAAGGG
TGGTCAGATTGCTGACTTGCGTCGCGGCGTGGAGATTTGCATTTGCACCCCCGGCCGAATGATTGATATGCTGAGCATGGGCAAGACAAACTTGCGTCGT
GTTACGTacctggtgctggatgaagctgaccGTATGCTTGACATGGGTTTCGAGCCCCAGCTGCGCAAGATCGTGAGCCAGATTCGTCCGGACCGACAGA
CTCTGATGTGGTCGGCGACTTGGCCCAAGGAAATCGTAACACTAGCCCACGATTTCCTGACTGACTTTATCCAGGTAACGGTGGGATCACTTGACCTGAC
GGCCAACAAGAGGATTAAGCAGATCGTGGAAGTCATGGATGACCACCAGAAGTATTCGTCGCTCCAGGACCACCTGCGCGATATTTACGAGGGTGGCCGT
ATCATCATTTTCTGTGAGACCAAGCGTGGCGCCGACGAGCTGAGCCGTAACCTGCGTAACACCCGCTACATGTGCAAGGCTATTCATGGTAACAAGTCGC
AGGAAGAGCGTGACTACGTGCTGCGTGAGTTCAAGGAAGGCAGAACGCAAATTCTTGTAGCTACGGATGTGGCGTCGCGAGGTCTGGATATCAAGGACAT
TCGCTATGTGGTCAACTTTGACATGCCCAAAAATATCGAGGACTACATTCACCGTATCGGCCGTACCGCTCGTGCTGGTAACAAGGGTACATCCATTTCG
TTTTTCACGCCTGGAACCAACAGCCGCTTGGCTGCACCTCTGGTGGGCATCATGGAAGAAGCCGAACAAGAAGTGCCGCGTGAGCTACGCGCGCTTGTgg
gtcgtggtggtggcggcggcggtggccgtggtcgtggtggctacggtggcggcggtcgtggccgtggccgtTGGTAA