Transcript Name :
Phyci_111395
Orientation:
(-)
Number of Exons:
4
Description :
unnamed protein product
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ACT domain12.36PS51671
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-241
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
amino acid bindingGO:0016597IEA
metabolic processGO:0008152IEA
KO ID
K01653
K01653
K01653
K01653
K01653
K01653
*** None ***
Sequence
        1107 bases(100 bases per row)
ATGCTGAGGAGGTCTGTGCTGCCCCTGGCGCGCCGCGCGTTCCCGCGGTCTGCGGCCGCCATCGCGCCTTCCTGCGCCGCCCCCAAGTTCTTCTCGCGCT
CGCTGAGCGTGGCGGAGCAGAGCCAGCGCCACGTGATCGCCGCGCTCGTGGTCAACCAGCCCGGCTGTCTGGCCGAGATCGCCAATCTCTTCGCCGCCCG
AGGTAGATAGATACGCGAGGCTTCTCTAGGATCCGCTCCGCAAAGTGAAGACGACAGGGACTGAGCTGGGCGTGGGTGTCTGTTTGATGCAGGGTACAAC
ATTGACAGCCTCGTGGTGGGCCGCACGGAGGTCGAGGAGCTCTCTCGCATGACGGTGGTCGTCAACGGCACTGCCCAGAGCGTTGTCAACGTACGGAAAG
TCGAAAAAGAGCTTTAGGGAGGGGAGGCAAGAGACTAACTACTCCTGGTACGGACTTTGTGGTGGTGCAGATGAAGAAGCAGCTGGAGGACGTCGTGTAC
GTGGCTGTGGTCAACATCTTGAGCAGCGGCAAGAACGCCGAAAAGAACTACGTCGAGCGCGACCTGATGCTGGCTAAGGTGTCTACTGCCGGTACGCCCT
CACTGCTGATAATGCTACCTTACCCCCGGAATCTAGTGCAGGGGCTAACGTTGGCCGTGTGTGTTGCTGCTACATGCAGAGGCTGGATCTCGCGCTGAGG
TGGTGGAGCTTGCCAACCTGTTCGACGCCAAGGTCATTGACGTGCGACCGCACCAGGTCATGGTGCAGCTGGCCGGCACCCCTGGCCGTATTGAGGCCTT
CCTGGACCTGCTGAAGCCCCTGGGCATCACGGAGATCCACCGCAGCGGTGTCATCGCCATGGCGCGCAGCACCAGCGTGACCGACAAGCTGGGCGACCTC
TCGACGTTCGAGGGCGCCACGCGCACGCTTCTGGACGAGGCTGACGACGTAGAGGTTGACGTTTCGCGTCTTCCTCCTGGATAAGCGACCTGGGAGGCGT
TGGTAGCGTCCGCGGTCTCGCGATCGCTTTTTTCCTGTCGGTAGTTTGCATTTAGGAACGCGCGCACTGCAGTGGGCGTGTCGTCCAACGGGGGGAGCAA
GCGTGCT