Transcript Name :
Phyci_111123
Orientation:
(+)
Number of Exons:
4
Description :
protein phosphatase 2C putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Protein phosphatase 2C (PP2C)-like domain6.8SM00332
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-421
NN-scoreoddsWeighted Score
0.6344.710.009
*** None ***
TypeScore
mitochondrial435
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
*** None ***
*** None ***
Sequence
        1972 bases(100 bases per row)
ATGGCGAAGCTGTCCAGAAACTTTGCTGCATCAGCTTTTTGCGCGCTATGTATCGTGGTCAGGCACTCGAGCTGGCTGATCTCGCAATACACTACAATGC
AACGCTTGCTCATGTGCGGGGGCATCCGTGGTGAGTGAGCATTGAAGCTGGCTGCCGACTGAGCGGCGAGCAGAGCTGCAGCCATCGGTATGCCTGACGC
ACCAAGCGTCCATGATATCTCCGTGCTGCGGCCAAATCACTGGGCCAACACTTGCCTTTAGCTATAAGTGGTCACTTGCATGCATAGTTGACCGAGCTAG
CGCTACGGACGTACTAGTATTGCCGGCTCATGATCCCTTAGTCAAGCACTTCAACAGCAGATGGCAACTATTCCGTCGCCACTTCAACTTCACAATCGAG
CGACACGACATTTCACTACGCCAATACGACAGTTCGTTAGGCCCTCAGTTCCCCTGGTTCAATCCAGCTTGGAGACGACGTCGCCAGCATGCGACTTTTT
GCTGCACGGAACCTGGCGCGCCTGGCGCGGGGACAGAGCCACAAGGTGCGCGCGCACTCCTGTCACTACCTTAGCACCTCCCTCTGTCCAACCACTGCAA
AATGCAGCCTCCCCGGGCGCTTGTGGCCCGCTGGGAGCCTCTTAATCCTCAATCCCAACTCACTCCTTCGCCCGTTGCGCTTGTCAGTTCCACGGCTCGG
CGCTGCGCCAAGCGCTGCTCTTGAGCGGCCTGGGGCTGTCGGTGCTGGCCCTCGCGCACGCGGAGCTCACGGACGTGGGCGTGACGCACCTGGAGGCGCA
ATGCGACGCCCGGTACGCTCCGCCCGAGGTGGACGGCGCCTTCTCCGTGCCGCTCGAGCGCGAGGAGTTCGCGCCCATCGCCAAGTCGCGCGCGACGCGT
CTCAGCAGCGCGTCGTACAAGGCCAACTTCCCCATCGAGGACAAGTACGCGGTGGAGGCGACGGACTCGGGCGACGTGTTCGCGACCGTGCTGGACGGCC
ACGGTGCGCGCTGCCTGGGGACCCGCAGCAAGTCCAGCTCTTTGCATTCTGACTTGTTATATTGTGCTGGTGCTTGCAGGTGGATGGCAGGTGTCCGAGT
ACGCGCGGAAGACGCTGATCGGCAACGTGCAGAAGGAGCTGTCGTACCTCTACAAGCCGGGGACGAAGGAGCCCGCGCAGGGTGACTCGAAGACGGTCTC
GGACGAGCGCGTGGCTGCGGCCATCCAGCGTGCTTTCGGGCGCACGGACCGCGACCTCATGGCGGAGGTGGCGTCGGCGTTCAAGCTGGGTTTCGGATCT
GTGGCGCGGTGCGGATCCTGCGCGTGCTTGGCGTACGTGCATGAAGGCACCGTTCACGTTGCGAACGCGGGTGACATCCGTGCAGTGCTGGGAAAGAGTG
GCAAGGACTCCGAGTTGATCGTCGCTGAGCCACTCAGTAACGACCAGAACGCTATGGTGAAGTTCGAGCAGGAAAAGCTTATCGAAGAACACCCGGGAGA
GGCTAACGTTTTCACCTGCCGCCACCCGGATTCCTGCTACGTGAAGGGCGCGTTGCAGCCTACGCGCGCTTTTGGCGACTTTTCCCTGAAGCACCCGGAG
TTCAATGGCCCGCCTTACGTGAACGGCGATCGCTCTGCTGGCCGCCACTTTGCGGCGCCTTTCACGCCGCCCTACATCACGGCTATCCCTGAGGTCAAGT
CTCACAAGCTCCAGGAGGGGGACAAGTTCCTCATCATTGGTTCTGATGGCTTGTGGGACTACCTAAGCAATGAGGAGGCCGTGGAGGTGGTCAACGGTCA
GGCTTCATGCGGAAACCACGACCTTGCCGGCCGCGCGCTTGTGGAGCGGGTGCTTCAAAAGGCAGCGAAGCGCTACGGCATGACGTACCAGGAGCTGCTG
AGCCTGCCGCCTGGAAGTCACCGCCGTCGCCGTCACGATGACACGACGGTGGTCGTTCTCTTCTTCGACTAG