Transcript Name :
Phyci_331717
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myb domain11.594PS51294
HmmSmart predictionP-Valprediction_id
SANT/Myb domain2.9SM00717
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Myb domainIPR017930
*** None ***
InsideOutsideTMhelix
1-250
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
chromatin bindingGO:0003682IEA
*** None ***
*** None ***
Sequence
        1186 bases(100 bases per row)
AAGGCGTTGCCGGCGATCGCTGCGGTCGGCATGTCCGCCGTCCTCACTTCTTCCTTCGGCCCAGGCGCTCGACCGCCGGACTTCTGCACGCGGGGCGGTG
ACCGCCCGGCAACTGTCCTCCACGCCAGCAGCGCTCGCCCCAGCAGCTCTCGCCGGACAGCCAGTGACGGCGCTGAGACCGTCGCTCGAGCGCACTCAGC
CGTAGCCTGTTTTTCTCGCATCTAAGCGGGGATGGCGGTAGGTAGCAGCGCCGGGCCTGAGAGGGAGTGTTTACTGACCATAGGGGCTCTACCGACATTG
ATAGGACGTGCCGACCTCCAACGTGGTTGTCTTGAACGGATCGCCGCAGCGCTGTCATTCCCAAATTCGCCTCACATCGAGCGAGCGAGCAAGCAGCCAG
CCAGCGGCATCCACGCCAGCGCTCTTCGGACGCACCGCCGACAGCCCTTCCGTCACCATGAACATGGTTGCATCTGGATCAAGCTCGCCCGTGGCGGCCA
CCAAGCCCAAGGCCAAGCCCATTTCGCCGACGGCCAAGGGTATCtggtcccttgaggagcacgaccgcttcctcgaggccatgaagctctaccccaaggg
cccgtggaagaccatcgccgaccacatcgccactcgctccgtgcgccaggtgcagacccatgcgcagaagtaccaggagaaggtGTCGCGCCGCCTGCGT
GGACTGCGCAAGTCGAAGAAGAAACTCGTGCGACCCGAGCACCGCATCGACGAGGACACAATGGAGCTGTGCAAGTTGGTGGACTGCGCGGCGGAGAAGC
TGGTCGCAGCAAGCAGGAAGTCGTCGTCAAAGGCCGGGACCGTCAAGCTAGAGCCGCTGCAGAAGAACCTGGTGAAGGAGGAGCCCTCCGAGGCGCACAG
CAGCCCGCGCGGCACCGACGTGGAAATGAAGACCGACGACTTCTTGCCGCTGCCGTTCCTGGACTTTGGAGACGACATCGATCTCGATCCCGTCCATATC
CCTACCGTGAGCGAGTCACTAGACTTCCTGATCGACTACCTGTCGATATAACCTCCTGCAGCTGGGAATCAGTTGCTATTAGTTCTGTAGCGATGGGATA
GACCCGTCATTATTTGGTGCGGTATCCGTGATCAAGCGCCCCTTTCAGAGGAGGTGACTTCATATTTATATCATAAAGAGGAATGC