Transcript Name :
Phyci_12
Orientation:
(+)
Number of Exons:
3
Description :
pumilio-like mating protein M90
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pumilio RNA-binding repeat109.116PS50303
Pumilio RNA-binding repeat8.244PS50302
Pumilio RNA-binding repeat11.114PS50302
Pumilio RNA-binding repeat9.854PS50302
Pumilio RNA-binding repeat8.291PS50302
Pumilio RNA-binding repeat10.577PS50302
Pumilio RNA-binding repeat10.507PS50302
Pumilio RNA-binding repeat8.687PS50302
Pumilio RNA-binding repeat8.991PS50302
HmmSmart predictionP-Valprediction_id
Pumilio RNA-binding repeat0.0023SM00025
Pumilio RNA-binding repeat2.4SM00025
Pumilio RNA-binding repeat0.0011SM00025
Pumilio RNA-binding repeat0.016SM00025
Pumilio RNA-binding repeat1.9SM00025
Pumilio RNA-binding repeat1.7SM00025
Pumilio RNA-binding repeat0.0019SM00025
Pumilio RNA-binding repeat4.5SM00025
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-887
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
*** None ***
*** None ***
Sequence
        2825 bases(100 bases per row)
ATGGGCCACAGCGACTCGATGAGCCCCGCCAAGAGCAGCGGCGGCGCCCCCACCTCCTCCTCCCCGTCGTCGGCTCCGACGCAGCAGCCGCAGCCGAGGA
TCGCGGCGCTCGAGAAGCCCGTCCATCACGACAACCCCGTGGAACCGGTGCGCGTGAAGCTGCAGGACCCCGCCGGGTACCCGTCGGACTCGCTCTGGTC
CTCGGAGGGCCTCAAGGCCCGCTCCTCACTGCTCTTCTCCTCATCGCAGGCGCTGGCCGAGCGGCCGGTCAGCTTCGCGCTGCGAGCCCCGCGGCTGCAG
ACCAAGGCCGACTCGCGCTCCGTGCACAGCGCACAGACGACGCCCCCGAGCGAGTCAGAAGAGGGCGACACGGCGGTGGACAACCAGAAGGAAGATCAAG
AGCAGCAGCACGAGGGTGGTGGCGCCCCATCTGAGAACGGGGGCGAGCTGCGGTCATCATGGGGAACGGCGCAGAAACTGTCGAGCAAGGTAATTGCTTC
TCTCTCTCTTGGCTCGCTGGCACGATCTTCGCTTTCTAACGCTCACTGGCGTCATTCGTTTCCGTAGCAGGACGAACAGCCAACGGACAACCAAGAGCCG
GAGTCGAATGGGCTGTCGATGAGCCTGGTGCGTTCTATCTTGGTTCAACTCCTTCGACCCACGCGTTGCAGCATCTTCTAACTCGATAGTATTTGTCGCA
TGTGCTGCAGCAACTGCGCGAGCGCGAGACTGCGCTGCAGCCTCGAAGCAGTGACCGCCACTCGGCGGACATCTGGACGAACCCTCACAACGACTTTGAA
GACGGCGAGTTCGACTCCACAGTCAGCCCCACCACTTCCCCCGACAAGCTCAACCCGCGCGCGGTTCCAAGCTTTTCTCAGTCGAGCGCCAGTACGTCAA
GGGGCATCTCCACGCGATCGTCTCGCGGTGACAGCCAAACCCAAGCTGGTGGCTGTCGTGTACCACCGGGAATGTCCTTGATCGACCGGATCCAAGAGGA
CTTTCCCCGCACGCCATCGCCTGAGTACGGGCCCTTCGAGGGTGAAGGCTCGAGTGGGCACAGACCCTCCTTTGGCGGAAGAGACCAGCAAACGCAGTCG
GTCTTCGGCATCAGTGAGGGAATGGGGCAGCTACGACTTGGCAACTATCGAGAGGCGCCGCTTTACGATTCTGGCCGTCGTTCTGGTCGCGAATTCGGTG
ATCTGCCTCGAATGCCGCAGCACGCCACTGCCCTCAGGCTCGTTGGAATGAATGGCCACCGCCACACGTTCGGCAGGAGCACCAGCGAGCCACCTTTCGG
CGGTTCATATCATGGAGCGATGGCCCAAGGTTTGTCGCCATCCTACAACATGGGTGCTCAAGGTGTTCAGGGCTACCCAGTTATGATGGGTGCTGGCAAG
GCGCGATGGGCCGCCGACGACGAGGCATACTCGTTTCCATCGTCACCTTTCGGCTTTCCGCCGTCTGACTTCACGAGCTCGCACCCTGGCTACAATTCAA
CCATGCCGAATTACGGGGTCGGCTACGCTGGGGAGTACCGCGGCATGAAACCCTCCGACAAAATGTTCAAAACCCGCCCGTCATATCCGCTGGTGGACCA
CCCGCTGTACGAACGTCAAGACTTCGGAAACTACATTCCGCGTCCGCAGATGTTGCAACGACCCAAGGTCGGAGGCCCTCGACGAAGTGAGTTCGAGTAC
TTCCACCCGATCGCGCACTCGTACTCGTCCAACAGCCTGCTGGAGGAGTTCAACTCGGCGCCGAAGTCGGAGAAATGGGGTCTGTCTTCCATCAAAGGAC
ACCTCTTCATCTTCGCCAAAGACCAGACGGGCTCGCGATTCATTCAGCAAAAGCTAGAGAAGGCCGACGAGCACCTGAAGGCCGAGGCATTCAGCGAGAT
CTTCCCCAACTCACTTTTGCTGATGACGGACGTGTTCGGCAACTACGTGATCCAGAAATTCCTTGAGTACGGCTCTCTGGAGCAGCAGCAGCTTTTGGTG
GAGTTGATGACGAGCAACATGATCAGTCTGGCATTGCAAGTGTACGGATGCCGAGTGATCCAGCGTGCATTGGAAGTGACGCAGGTTGAAGAGCAACTCG
CGCTGATCCGACAGCTAAAGGGCCATGTAATGAAATGCGTCGTTGATCAGAACGGCAACCACGTGCTGCAGAAATGCATCGAGGCGGCGTCTTGGAAGAG
AGCTGCCGAGTACAATGGACTGGGCCCTCAACGCTTTGTGACGGGGGAGGACATCCAATTCATCATCGACAGCTTCGTCGGCCACGCTGCGGCGCTCTCC
ACGCATTCGTATGGATGCCGTGTGATCCAGCGCGTGCTGGAGCACTGTGAGCCTGCCCAGATCCGCCCGCTGCTGAACGAGATCATTTTCAAGTGCCGGG
AGCTTGTCAAGGACCAGTTTGGCAACTACGTTGTGCAGCATGTCATCAGCCACGGCGAGCCGGATCAGCGCAACATCGTCATGCAGGCGGTGCTTCCTGA
GATCGCGCGCTGGAGTCAGCACAAGTACGCGAGCAACGTGGTGGAGTCCTGCCTGGAGCACGCTACGAAGGAAGAGATCAGCCAGATCGTCGACTTCATT
CTTCGATGTGATGAGAGTGGAGCGTCCTGTGCACTGCTTCCCATGATGAAACACATGTACGGCAACTACGTGGTGCAGAAACTGCTGGAACGTGCGGATG
ACCACGACCGCCATCGCATTGTATGTATTATTCGACACAATGAGGACTACTTGAAGCGCTTCACTTTCGGAAAGCACGTTTTGAGCCGGCTGGAGCGCGA
GGAGCAGCCGAACAACTACTTTTGA