Transcript Name :
Phyci_88701
Orientation:
(+)
Number of Exons:
1
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Haem peroxidase, plant/fungal/bacterial2.4PR00458
Plant ascorbate peroxidase2.1PR00459
Plant ascorbate peroxidase2.1PR00459
Plant ascorbate peroxidase2.1PR00459
Haem peroxidase, plant/fungal/bacterial2.4PR00458
Haem peroxidase, plant/fungal/bacterial2.4PR00458
Plant ascorbate peroxidase2.1PR00459
Haem peroxidase, plant/fungal/bacterial2.4PR00458
Haem peroxidase, plant/fungal/bacterial2.4PR00458
Plant ascorbate peroxidase2.1PR00459
Profile scan predictionP-Valprediction_id
Haem peroxidase, plant/fungal/bacterial17.245PS50873
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-341
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
peroxidase activityGO:0004601IEA
response to oxidative stressGO:0006979IEA
*** None ***
*** None ***
Sequence
        1206 bases(100 bases per row)
CCCCGCAAGCGCCCCGCAAGCCCTCGTCGCCCTCGCCATGTTCCGTCGTGCCGCCCTCCGCGCCGCCCAGCAAGCGTCCGCCGCCTCCGCCGCCAAGTCG
CGCAGCTTGGCCACGGCGCAGTTCCGCGCCGCCCACAAGAACAAGCAGCCGAGCGCCATCGTGCTGGCCGCCGCGGGCGTGGCCGCCGTGTCGGGTCTGG
CGCTCACGGACCTGGTGAACGCGCGCGAGAAGCCCGTGGACCTGGCCGCCATCAAGCAGGAGATCGTGGAGATCTTCGACGACGACAACTACATGGGCCC
GACGCTCGTGCGCCTCGCGTGGCACTCGTCGGGCAGCTACAGCAAGGCGGACAACAGCGGCGGCTCCACGGGCGGCACCATCCGCTTCGACCCGGAGATC
AACCACGGCGGCAACGCCGGCCTGCACCTGGCCGTCAAGGCGCTGGAGAAGGTGAAGAAGAACCACCCGGAGATCTCGTACGCCGACCTGTACGTGCTCG
CGGGCGTGACGATGATCGAGGAGATGGGCGGCCCCGAGATCCCCTTCCGCCTCGGCCGCCCCGACGCCAAGAGCGGCAAGGAGCCGACGCAGACGCCCGA
CGACCGCCTGCCCAACGCCGACATGGGCAGCAAGGACAAGACCACGCAGCACGTGCGCGACGTGTTCTACCGCATGGGCTTCGACGACCGCGACATCGTC
GCGCTCGTGGGCGCGCACGCCATCGGCCGCTGCTACCCGACGCGCAGCGGCTACAGCGGCCCGTGGACCAACGCCGAGTGGACGTTCTCGAACGAGTTCT
TCCGCGAGCTGCTCGAGAACAAGTGGACCATCAAGAAGTGGAACGGCCCCGCGCAGTACGAGGACCCCACGGGCAAGCTCATGATGCTCCCCGCCGACAT
GGTGCTGATCCAGGACCCCAAGTTCAAGAAGTACGTCGAGCTCTACGCCAAGGACGAGGAGCTCTGGTTCAAGGACTTCTCCAAGGCCTTCGTCAAGCTC
ACGGAGAACGGCGTCAAGTTCCCGGAGACCTCGGGCTGGCGCAAGTTCTTCGGCGGCAAGTAAACTTGATGCCTTCTGAGGGATGGAACCTCCGTGTTTG
CGTGAGTGCTGCCAGCCTCAAGTCTCTGGTAGCTCATTGGACTCCCGCCACAGCAACAACCGCTGCGTGCAGACCAGCATTGAGGAGCTGGTCGCAAGCG
CCTAAG