Transcript Name :
Phyci_100017
Orientation:
(+)
Number of Exons:
4
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Tudor domain2.1SM00333
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Tudor domainIPR002999
*** None ***
InsideOutsideTMhelix
1-234
NN-scoreoddsWeighted Score
0.6656.6010.013
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        1178 bases(100 bases per row)
ATCGTGTCGGGCCCAGCCGGCGGCGAGCGCCGAGACGCCTTCGTTCGTGTGCGTGCTGAAGGCGCAGGACGTGGCGCCGGCTGAATGGAGTGTGCTGCGT
GTGACGCGTCATGGTCTTCGGCTCGGCAACAGATGCTGCACTAAGTCACTTCAACTGCGAGCCACGGCCAGACCGCCGGGACGTTGCGCGAGGGTTCCGT
AACGGGCGGGTGCTCCAGCAGGCTGTTTGATTTTTGGCAGGATGGCCAGCAGCAGCAGCAGCGAGTGCAGCACCGCCTTCGAGGGCTCCGTCGTCTCGGC
TTCGGCCGCGTCGGAGCAGTACGATGACGACGACTTTGACGACTACTCCGACTCGTTCGAGTCCGAGGACGATGGTGCAGGCTCGGACGCCACTGAATCC
GCTGCGGCGGCAACCTCCAGAGAAGTTGACCTCGCGCTGCTCCGCGTCGGGGTCCGCGTGCAGGTCTTCTGGATCGAGGAGAACGAGTGGTTCAACGGTC
TGATCCAGCGTGTCGAGGAGGGCAACGAGCCGCGCTACTTCGTCCATTACGACGACGGAGAGCAGGCCTGGGAGGTAGGATATTGTACATGCACCTTGGT
GTTCGTCACGAACGACGAGCTTCGTCCGCCGTGATCTAAAGGTGCGGATCGTTGTCTGGCATCGTCGTTCACTTGTAGGGTCCTGCTAAGATCCGACCTC
TCCCCGCAACGCACACCAGCGCAGATCAGTATGATCAAGTGCAGCAGCTACTGCCGCTGAGTGAGCGGAGCGCTCGAGCGACGGTGGGGCGGAGAGCGAT
CGTGTACTGGCCGGACGAAGCTGAATGGTTCGATGGCGTTGTGAGCAGCGCGCAGGCCTCGCCAGCGGCACTAGAGATCAAGTACGATGACGGTGACAGC
CGCTGGGAGCAGGTAGGGAGGCGGGATTGCTCTTGTCTCTCTCGTTCGCCGCGCTAACTTGCCCTCTTTGCATAGGAACACGCGTTCAATTGCATCCTTT
TGCTACGATCAACAGTCGAGGCAGTCGAGGCAGTCGAGGCACCCAAGACCATCCCTGGGCTCGTGGCAGCTCCGCTGTCTCCTCCGGAGCGGGTGCTGTA
TGCTCGCCCATACAGGGAAGTTGTCAGTGACCACTTCCAGCCTGTGCGGATTGCAAGGCCATACCGCTGTGTCGTTGA