Transcript Name :
Phyci_111132
Orientation:
(-)
Number of Exons:
2
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DENN domain22.866PS50211
HmmSmart predictionP-Valprediction_id
DENN domain9.1SM00799
dDENN domain1.3SM00801
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
dDENN domainIPR005112
DENN domainIPR001194
*** None ***
InsideOutsideTMhelix
1-1376
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4229 bases(100 bases per row)
ATGAGCGACGACTTCGAGCGCGCGCAGACCCGCACACGGCCGCGACGACGCAGCCGCAGCAGCGGCGCCATCCTCAACACGCCGTCCAGCGCTGACGCCA
GTTCCAGCGCCCATGTCAACGTCACCAGCGCCATCAACAACGGAGAGCGCACGCTGCTGCCCAGCGACATCGTGGAGCTCAGGCGCAGCGCGTCTGCAGA
CCACGTGGTGGGCGCCGGGCGCCTGAGCCGCTCGGGCTTCAACCCGTTCAGCCACAGCGGCGGCCTGCGCCTCAACAGCGCCGGCTCGAGCTTCCGCGCG
GGCGCGGGCGTGCCCGTGTCGTCCTCGGCGCTGCGCAGCCACGCCAGCTTCCTCATGATGGACATCGACACGGCCAGGCAGTCGGTGGACGCGCAGACGC
AGGCAGCCAATGCGCGGGCCGCCAGCTTCGACGAGGAAGACGGCGTGGACGACGGCGGCAGGCTCACGAGGAACATGCTGGGGGACTCGACCACGGGGAG
ACGCAGCAGCGGCGAGAGATACAGGAGAGCGTGTACGTTGGTTGGGCAAAGGGTGAGGAAGGTGGAGGTGGGAGACTGATGCAGttttttttgttttatt
ttattttttattttattgtttttatGATAGCTTCGTTGGATTCGAGTCCGCCGTTGCCGCCGGATAGCACGATATCGGCGGAGGAGGTGATACGAGAGAG
CATGGCGAGCGCACTGAGCTCGTCGTTGTATACGGACAAGGACGATTTTTTATTGCCGCACCAACGAAGGTCGACCGCGGTGAATGGCATCGCAGGGCCA
GGGAGCGAGAGAGATTCGTTGGCGATGTCGAGGCACTCGAGAGATAGCTTGGCGTTTTCGTTTTCAAGTCGCAGCACGTTTCGGAGGAGCACGATATCGG
AGCAAATGCTGTACGAGACGGATCTGTTCGAACCGGAACGGGAGTTGAGTGTGCGCGAGCTGTCGGAGGTGCTCAGTGGATCGGACGAAGATGGCAATAG
TTATGAAGTCACTAGTATAAAAGAGGAGGAGGAGGATGTCAAGCTCGAGAATGCCAAGTCTAGGTGGGCGCAACACGTTAAGCTCAAGGCGCGGAGCTTC
CTCTACTCGACAGTATCAGGCAATAAGAATGGAGCGTCAGCTTCAGGTGACAGCAACAATAGCGGATCCATGACATCGGCTACACCAACGTCGGCAGAAA
TTTGGGCGACCAAACAGAAGCAAATTCTAGCGCAGATGAGCAGCGGCAGTGGTTTTGGTGCAATGTCGGGTGCCTCATCAGCAGCGTCGTCTTCATCAAC
CCATCACCACTCTTTGCTTCCGTTGCCATCGTTCGGGCCTGCATCGAATGGTGGCGCCAAGTTTCAGAAGTGGAATCGATGGATGCACAATCAGTATCAG
CACAATTTCGGCAAAGTAATGCAGCGAGCTTTTAAGGACGAGGTCTTGCAGCAGCAAGAGCAGCAGTTTGCTTTCCCAGCACACCAACCGACTCCAGATC
CGACAGCGCTTATATCCATAGAAGAAGTTATCAGCAACCCGCGCATGATGCGGTACTACGCTGCTTGGCTCCCTGATCCTGCAGACCAGAGTAAACTATT
TTTCCTCTGCTCATTTGAGGAGTATCGTCAATTTTGGTGCACCTTGCGTGCAAATTACCAGAAGAAGCCTTTTGCAAAGGACGACGTGCTAATGCTGCGA
ACCTATGGCGTCAAGATTGCGATGAAATATCTGGCCAAGAATGCGCAATTTCCGATTAATGGTACCGCAGATGCTGAGGGTGAAAGTGGTGAGCCTCCGA
TCGTAGATTCTAATAAGCTACGCACGATTAAGCGCGATCTAGCGGCTGGAGGTGAAGATGCACTACGAACATTTGATGATATTGCTGTGAAGGTAAAACG
TGTCCTGATGTTCAAGTTTCCGGAGTTCCGCAAAACCGAGCTCTACACTGAAATGCAAAAGACTGTGGAGCGCGAAGTCATCTGCTTGGAGGACATTTTG
ATGAACCATCGTTTCGCCAATTTCTTCTGGATCTTTCTGTTCCCGCACAACTACCATCGCGAAATTGCCCTGTGGCTCGACGTCGAGTACGAGTTTAAGC
CAGCATTCCGCATTTATATGGCTCTGCTTAAGTCCAGCGGCAGCTCACGAAGTGCTGCAGCACCAAGCAGCACAAGTAGCAACCAGCGTCGTGAGCGGAT
AGAACAGGCTGCATATCGCTGCAGAAGGTTGCTCAAGTACATTTCACAGAAATACTATGCTGGGGACACTGAGATGCAGACTCTGTCGCGTACTTTGGTG
ACATCATGTGCCCGCCTTCAAGCTGAGCAAGATGCCATTTTGACCAAGTTTAGTCTCATCCATCTGGAACTATATCATCGCTTTCTCACAAGCCGTGCAT
ACGCTGAGTTTGCGCTATACCCAAAGCTATCTCCAGAGGACGAGAAAGACTCCATTGATGATTCAATGCGACTCTCGGCACTGCTTCTGAGTTATGGACT
TCGCGCGCATCACTGGACCGGGGGCAGTTATGGTTCCTCGTCGTCTAGCGCGTCAGCGTCATCTTCGTCTAATTCGCGTGATGCTGAAATTTCAACACCG
AAAAAGAAGACGCTTGACTCGCTCCGTACTGCGAGAAGTTTTGAGGCCGTATCTGGCGTACTCACCTTTGAAGCTGTAACAGCGCCTGCAACAGCTGAAG
ACGCAGAAAATGGCACTGGCGAGAACGGTGATGCAGTGTATGAAGAACCGATTGAACTACAGGTAGTGCAGCATCCTTTGCCACATGACCCGACACCACA
CCCCGTGGACAAATCTATTGAGAATTTTCTGGTTCCGTGGTGTGCTGATCCTCGGCATGTCGTGCTCACAGCACCATCCTGTCCAGCGCCTCTGGCATTC
AACTTTCGCATGGGCGATAGTAGTGCTGGTGCATCGGTGGCCGAGCTGTTTGCGGCTTGCTTGGTATTTTATAAACCAGCACCCCCATTGTCGCGCCGCG
CGCTCGAGTCGTCGCGGATAGATCCTGGTTCGGGCTGCCGATGGGTACCGTATGGTGTGTGCGTGCTGTCGAAATTTCCAATGGTTGACCTGCTTCGAGA
ACGGCTCGCCGAGGCGTATGAGTTCATTCTTGAACTTGAAACTATTGCTGCTGCCGCGGCTGCTAACGGTGACGGTAAGGGGGTACTTCATAACGGTGGA
CAAGGTTTTCAGCTGGACAAAAAAGTTCTTGCCAAACTCACGCGTGCCGTTTCCAAGGAGCACGTTTCACAGTACCACCAACCATCACCGCTGCCAGAAT
CATCACTCCTTGAGGCCTCCGGCTTAACCCCAAAAGCGACGTCTGCCTCGCTACTTGCCGCTCTTCCGCGTCTAGACCACTCCGTGAGGTTACTCTTCGA
CACGCTGGACGTTTCTACTGTGCTTCTTGTGTTCACTGCAGCACTGCTAGAAAATCGCATTCTGCTGGTGTCGTCGTATCTGTCGGTGCTTATGAAAGTC
GGCGAGTCCCTGCGAGCACTTATGCATCCATTATCTTGGCCGCATGTGTATCTACCGATTCTTCCTCGGCGAATGTTGCAATATCTTGAATGTCCCACGC
CTTTCATCTTCGGTGCTGAAAAACAAGCTCTTGAAGAAGCCCAGCGGCAAGTGGTTGAAGAAGGTGGGGATGACTTGTTTGCGGGTGCCGGAGAGGAGTT
GCTGGTTGTGGACTTAGACAAGGGGGCTGTTTTACGTGGAGAAGTACCCTGTACGCTTCCGGATAGCGTGCGGTTTGCTTTACGCGATGCTCTGTACGAG
TGCCTGAAACCCAACGTGAGCCGTAGTGACCACGTGTTTGCACACCACTTCCCGAGCAAACCACTCGTTTTCCCAGAGGTCGCAGTGCGTGGGCTTTTTC
TCAGGGCTGTAAACAAGCTCATCGGCGATTTTGGTTACCACCGCTACGTCTGGACGGATGAGTTTGCTCGCAAACGCACGGTCTTCTTCGACGAGGCGAG
CTATCTTGCAGCGTCCGCGCCCGATATGCGTGAATTCCGCACGTTATTCATCGCCACTCAGGCCTTCTCGGAGTTTATGGTCTCCCATCACGGCTTCGAG
GAGCAACCAGGCCAGGCTAATGGCAGCACTTTACCTCCGAGAACATCCACTTCGGCACCTCCCAGGAAATCCGCTTCTACGCCCTCTACTTCATCCTCGT
CGTCTGTATCATCGCAACCGTGGACCTAA