Transcript Name :
Phyci_206284
Orientation:
(-)
Number of Exons:
2
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-192
NN-scoreoddsWeighted Score
0.8721.1520.002
*** None ***
TypeScore
nuclear522
GO
*** None ***
KO ID
K02890
*** None ***
Sequence
        655 bases(100 bases per row)
ATGGGCGCTCTGACGCTCCGCCCGGCCGCCGGCAGCGCCTTCATGGGGCGCGTGGCCCGGGCAACGCTGTCCACCACCGCCGCGGAGGGAGAGACCGCCG
CGGACGACGACACGGCCGCGTTCCTGAGCTCCACGTCGCCCGCCGAGCCGCGCACCGTCAAGACCGTGAAGCGCGCAATCCGCGCCAGCCCCCGCAAGCT
GACGTACCTGGCGCAGCAGATCCGCGGGCTGTCGGCCAACGAGGCCATCCTGCAGATGAAGTTCTCGCCCAAGCGCAAGGCCGAGATCTTCCAGAAGACG
GTGCAGAACGCCATCAACCTGGCCGACATCAAGTACCAGATTGAGCCGGAGAACCTCATGGTGGCGGAGTGCTTCGTGAACAAGGGCACCTACCTCAAGC
GTCTGCGGATCATGGGCCGAGGTGCGCACGCCTGAAGTATTGTTTTGTAGATGCTGCAGTTGTCTGACTTTTGGTTGCGTTTACTTGTTTATTGCAGGAC
GCTCGGGTGTGATGCACCACCCGCACACGCACCTGACGGTGGTGCTGCGCGAGTTCGACCCGTCCAAGAAGCCGCTGAACCGCCACCTCACCAAGAAGCT
GGCGCGCGAGAACGCCAAGAAGCAGCTGGAGCAGGAGGCGACTGCCGAGGAATAG