Transcript Name :
Phyci_46
Orientation:
(-)
Number of Exons:
2
Description :
nucleoredoxin, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Thioredoxin-like fold11.992PS51352
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Thioredoxin-like foldIPR012336
*** None ***
InsideOutsideTMhelix
1-163
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        578 bases(100 bases per row)
ATGGGCGGGCAGCGCCCTTCCACGTAGCGCACCCTATTGTGTCCCTCACAGTACGTTTCCAGGATACCTCATCTTTTCCTTCTTGCTCATTTTACCTCTC
GCTGTCAAGCCACCAGCCCCGGAGAACTCGCAACAGAATGAAGTGGTCGGAACAGCTCGGCGCCAAGCTCCAGACGAAGGACGGCCTGCAGGACACGGAC
TACAAGCTGGCCGGCAAGAAGGTGGTGGGCTTCTACTTCAGCGCGCACTGGTGCCCGCCGTGCCGCCAGTTTACGCCCTTCCTGAGCGCCGTGTACGACG
ACATGATCGAGGAGCACCCGGAGTTCGAGCTCATCTTCATCTCGTCGGACCGCGACCCGGCCCAGTACAGCGAGTACTTCGGCGAGATGCCGTTCCTGGC
GCTGCCCTTCGAGGAGCGCGCCGCCAACCAGGCCATGAGCACCAAGTTCGGCGTCACGGGGATCCCCATGCTGGTCTTCGTGGACAGCGAGGGCAATGTC
ATCACCATGGACGGCCGCACCGTCGTCGCCAACTCGCGCGGAGACGTGGAGAAGCTCTGGGAGCAGCTCACCAAGTAA