Transcript Name :
Phyci_205762
Orientation:
(+)
Number of Exons:
9
Description :
fatfree family protein putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-816
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3085 bases(100 bases per row)
ATGGAGGACCACGGCCTGTCGCGCATGCAGGAGCTGCTGAGCAGCTACTACGGGCTGCAGGACCAGGAGAGCAAGCAGGAGCAGCTGCGCAACATCGACT
CGCCGGGCTTCGACCCCAAGGTCTACGTGAAGGTGGGGAAGTGAAGCTCCCGGAGGCCACGTGTACACCTGAAATGTAACCCTGCGTACCCTCGTGTCTG
CAGGAGCTGCTCGAGAGCCGCGGGCTCAATGAGCTGCTCACCACGGACGACCAGCTGATCCGCGAGATCAAGGAGCTGGACACCAACATGCAGATGCTCG
TGTACGAGAACTACAACAAGTTCATCAGCGCCACGGACACGATCCGCAAGATGAAGGTAAACAAATATTTTATGCATTTTCAGGGCGGCATGCTGCCCAA
ATTTTGAGTTTTTTTTACGTTACTTTATTGTATTGTATTTTTCGTGCTGCAGAACAATGTGGCGAGCATGGAGGAAGAAGTGGGTCGTGTGGTGAAGAGC
ATGGACACCATCACGGCCAAGAGCGAGAGCATCAATGTGGCGCTGGCGCCGCATCGCTCCAAGGTGGAGAAGCTCATTGGCGTGCGCCGGCTGCTGAAGA
GATTCGAGTTTATCTTCGAGCTGCCTCAGAGACTCAACACGTACGTGCGTAGGGAAGGGTGTGTGGTTGAGGTGAAAAGAGGTGCTGACGGTGAGGGTGG
CGCTGCAGTGCTGTGAAGCAGAAAGAGTACGCCAATGCTACCAAATACTACCTGCTTGCACGCCGGATTCTCGGGAGATATGAGCATATCTCATCGTTCA
AGGTGAGGTTTCGTGTGGGAGGAACGCTGTAATTGGATCGCTGGTACTGACTGTCGAGTTTGCTAGACAATTCAAATGGAAGCCGAGAAAATCATGCAAC
AGCTTGAGCGTCTGCTGAAGAAACGAATGCTTGACCCAACGCTTGGGTCCGAGGAGGTAATTGCGTTGCTTTTGCATGGCGGATTGTTACTTAGTCGTTA
AACTGAGTGTGTGACTTGGTGTGCGTAGCTCTGCGAGACGGTAGTGCTGCTGGATCAGCTAAACGCTTGCAACGACGAGATCCGTGACCAGTTTCTCGAG
TGGCACCAAGCATATTTTGAACGCGTGGTGACAGTTTTTAAGGTACAAACTTTTGTGTCAGTGAATAGGCAGTCCAGTCCAACTCCGCGCGGAAGATTCA
CTTTGGATGTCCTCGTAGGCTCACTCATGATATTAATGCGTCTTGGTACAGGCCCAAAGCTCAAGCGACTCGGTGCTCGCATTTCTGCAAAAATTTAACG
ATGAAGTGCTGACAAAGATGGGTCGGGTATTTTCAGTGTACAAGACCCACTTCATGCCCGACGTCGTTGCGCGCGAGAAATCGTCGACATCACGAAAATC
TTCTGACGCAGTCCGAGACGACTTGTTCCTCAGTTTTGTGAAAGAACTGTTTGCGTTGTATCTAAGCGAGTGTGTTGTTCAGTTTCGTCGACCCCACACG
GACTTTGTACGTACTTGTTACCCGTATCTGTTTAAGAAACCCGGTATTAACGAAATATCACATTTGAACAGGGCGCGACAGAAGAAATCCTCGAAGTGCT
GCAAGACGATGACCTTTCGGCTGACACTGTTAACAGCGAGTATTTCGTCTTCATGCGCGTGATGAAATATTTTGTATCACAAGTTCAACAAGTGGACAGT
ACGATCCCGATGTGTGGGCTGGCTGTAAATGCTACGGAAATCGTGGAGAGTTGTGTGCGCTTCCAGATTGAAGGTGTATTTCGGAAACTACGCGAAGGTA
CTGGGGAGCTCTTCGTCACGTCACACGAGGATGTATCCGGATTGGCTCGTAGCTCACGCGACGGCGGACAAAGTGTTCAGCCTTTGGCGCATGAATCTGC
AAAGACATTCACTGATATGATGCAGAAGGTGCTGCAGCAAATGGAGCCTATGGTGCAAACAGGTTTTGCCATCCTCTCGGAGATGAGTAGACTCTTCTCC
GATTTGGTTCAGGTAAGATTCACCGTTTGTGCTGCGACGCATTATTGTGTCATTTCTAACGAATTTACTTGTTATGTTTGCAGAGCCAATTTTACGACTT
TCTGAAGTGGTTTAATACGTCAGTACTCCAATATGCGGAACCGAAGCGTGCATTTGCACAAACGGATGAACCACTGCGAGGTGAAGAGCAAAACAACGTA
GCTCTCCCGTGGCTCGAGCCTACTCCTCAGTTCTTACTCTTCCTAGCCTGCATGTGCCAAGATCTCTCTGCGGAAGGCATTGGGGAGTGTGTACGCGGCC
TTATCGAATGCCTGCCAGCACCTTTATCCCCGTCTAAAACTTCTGGCGAACCAATTCGGAGTCATCAAATGAACCAACAGGACGTAACGCACATGATCGA
AGTGACCCGCGAGACGTCTGCGGAGTTGCTACAGCATGTTGTAAAGCTATACGGCAACCAGTTGTGCATCATCGTCCACAACGGGGTTTCTGCCACATCA
TGGGCTGACATGGACGAAGAACCTAGAAGTGTGCAGGAAATGATGGCGGCAGTGGTGGAGTCCACTTTCCGCTTCGGCAAGGAACTAGCGTTGGCGCTTG
GAGATGAACAAAGTGTTTTCATTGGAAATAACAGCCGCACAACGAGCCGCGACTTCCGGCGACGAGCGAGTGCGTTGCGGTCGCGCAATGCAGGAGTTAC
AGCCGCGTCATCAGGAATGCAGCTTGATGTGGATCGGATTTTCGCACGTAAGATCCATATTTTCCCATCTCAACTAGAGCTCACAGCGGACTCGTTCGTC
CAGACAATGCTGAAAATGTGCATAAAGGCATTCAGCGAATGGGTGAGACTTCTAGAGTTGTCCAAGTTCGGATTGCAGCAGATACAGCTGGACGCAGAGT
TCCTTCGCAGCACCCTAATGCACATTGTGGTGGCTGGGGAAGCAGAGGAGGAAGTTGAGAGCTTGCTGTCTGATTTGCTTTCGAATGCTCGCGCCCGCGC
CGTTGAGGATGTATTGATGGATCAGAGCAACGTGGTTGCTATCGTCAGTACCAAGAGTACTCAAGTTTTGTCTCGTCGAGGATGA