Transcript Name :
Phyci_88715
Orientation:
(-)
Number of Exons:
1
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
PDZ domain9.632PS50106
Zinc finger, ZZ-type12.208PS50135
HmmSmart predictionP-Valprediction_id
PDZ domain1.1SM00228
Zinc finger, ZZ-type6SM00291
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-669
NN-scoreoddsWeighted Score
0.6251.4520.003
*** None ***
TypeScore
nuclear696
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        2435 bases(100 bases per row)
TATCCGGAATTTTTCATCCGCCAGCGCCCGCTCTTGGTTTCACTATAGCCTCAACTATCGGCAAAGGGACGATAGAGACGATACTGAACGCAGGTGCGGC
CGCTCTCCACAATACGTTACACCCGGGCGAGGCAGAAGACATGGAGGCGCCGGCCGTCACGCCCCACGCGGAGTCACCCCGCGCCCTGGGCGGACACGCA
GCCACCGCCGTGAGCCCCGCCACCCCCGTGGACAGCGACGTGGGCGAGGTGGAGACGGAGAAGAGCCCCGTGGCGGCGCAGCTGAAGCCCCTCGAGGACG
GCGCCGAGTCGGACCGAGCGCGCACAGACAGCGACGACGAGGAGGAGGAGCCCCACAAGCCTCCGCAGTTCGAGGTGACGCTCGTGCAGGGCCCGTCGAC
GCCCGTGGAGGAGCCCACGACGCCCGTAGAGGAGCCCTCGACGCCTGTAGAGGAGCCCGACGAGCCCACAGCACCCGTGGGCGAGCTACCGCCTGAGCTC
AGCTATGACGAGCACCATGGGACTGCGGGTGTAGTGGAGAGGGAGCTGGTGGTGCAGGAGGAAGTGGCTCTGCAGCACGGATACACGCAGAACCAGGAGC
CTGCGCAGGAGGCGCAGCCGTCGTCGCCTGTTGCTGGCTCTGTAACTGCTGACAAGGCGGAGCATGATATGGACGTCCAGACGCACGAGGTGGAGCTGGT
GATCCCGTCACCGAAGCGCCCGGCGCCGCTGGACCTTGTGCATCATGATATCGACGACGAAGCGAGTGACAGTGAAGAGGGTGAAGGAGCCGGAGAGGAA
GATGATGAAGAAGGTGCCGATCTCGGCACGCCTCTAGGCTATGGCGGCGCTGCGGATTTCGGTGAGCAGGATGAATTTGCGTCGCATCGTTTCTTGGGGC
CGAGCGTGGCCTCCGACCCATCGTCAGCTCGCGCGCTGCACAGCTTGCGCCGTGTGGCGCTTCATGACAAACCTCCTCGATTTGTGAGCGAGGCGTCGAT
GGTCCCGGCTAGCTCCGGTAGCGTGACAAGCAGCGGAGAGTCTTCCGGACGGAATTCGTCCAGCGCGAGTGCTATCCACGCGCCAGACCCGAAGACCGGA
CTGCGCTCGCAATCCGAGGCCGACTACATGGAGAACCCTCTCAACACATACACATTGACGTTTACAGAGCCCGTGCTGGGCTTCGACACAAACGTCGTAG
TGTCTCTGGAGAACGAGCTGTTGGTCGAAGTCTGGAGCGTGGATAAGGACAGCCCTGCGCAGCGTGCCGGTGTGGTCGTGGGCGACTACCTAGTCAGCGT
GAACGGACAGCACATCGAGGCCCACATGACGAAGGAGCAAGTATTCGACATCATTCAAAACTCTACTCTCCCCCGCACGCTCGTGTTCCAACGGGACGTG
CACGACAAGGACAGTTCGCAGTCGAAAAGCCTGCCCGACAAGAAACACTCCCCATCGAAGCCGCTGATGGGCCGTCTGGGTGCAGCTATGAGTACGGGGG
CGTCTATCATCGGCTCCAAGTGGAAGCGCAAGAAAACTATTGTGCACCCGAACTCGTTTTGCGATGGTTGCGGCATGGATCCCATTGTTGGCGCGCTTTG
GACCTGCAGTGTATGCTCAAATTACAATTTGTGCAATGAGTGCTATGACCTTGGCACACACGGCTTGGAAAATACGGAGCAGATGCAGGCGCTCAGCGAG
GCCATCGTGCAGTATAAGTTACAGAAGAAGTGCAAGCACTTCACGCCCGAGTTCTTGCTATCACTCCGCCGTGATATTTGCAAGGGACGACCCGACAAGT
TTGAGTATCTTGGCGAATGGATTGCGAATATCGTAGTGGGGACGGCTGCAGCCAAGATTACAGTGCGCGGTATCGAGATCCCGGCTCTTCCTCCCTCAGC
TCGCCAGCGCTTCGTATCATATCTAATGCCGTTGGTGTCGAACCGAACCGACATCGAGGTGAATATTGAGTGGCTACCGGACGATGCGGACATGATTAAC
GCTGCCGCCAGAGCAAGCGTGGATCGCATGAGCGTCGGGGCGTACGGCAGCAGCGACGAGGACAGCGCCGAGGTTCCTCGCGAGAATTTAGAGAAGCTGC
GCATTTGGATCTCCGACAAGAAGACGCGCACCACGTCGCCGTTTGCGTGAGCGCCCCGCCCAGGAGTATTTTGCATGTGGTGACGTGGAAGCAGACAGAT
AAGGCTGAGGAGGGCACGTCTCCGTGTTGGACTCGACCACCAGGCAAGGAAGGACGACGAGCTCAAGTCGTGGTATCGGCAGGTGGGCCTACCCTGAGAG
CGTGACGCTCGGCCAATTAGTTAGAGAGCCTTTTGTAGAGCTTCGTATCCGATTTCAATAAGCCGCACACAGCACAAACACCACTTCAACTGGTGTAGCC
ATCCCTATGCCCCTTTAACATAATACATAAGGCGC