Transcript Name :
Phyci_75474
Orientation:
(-)
Number of Exons:
7
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RUN21.509PS50826
Rho GTPase-activating protein domain20.657PS50238
Engulfment/cell motility, ELMO9.577PS51335
HmmSmart predictionP-Valprediction_id
Rho GTPase-activating protein domain1.6SM00324
TLDc2.8SM00584
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
TLDcIPR006571
RUNIPR004012
*** None ***
InsideOutsideTMhelix
1-1072
NN-scoreoddsWeighted Score
0.6042.2370.004
*** None ***
TypeScore
nuclear391
GO
Biological ProcessGO IDPrediction Method
cytoskeletonGO:0005856IEA
phagocytosisGO:0006909IEA
signal transductionGO:0007165IEA
*** None ***
*** None ***
Sequence
        3660 bases(100 bases per row)
ATGCTGGGCAAGATCTCGCACTGGCTGGCCACGCGGCACGAGGACAAAGGCGGCGCCGGCGACGCCTTCGTGCAGCAGCGCTACGACGCGCTCGTACGTG
CAGAGGCCGCGAGGTTTCCTTTGTGTGTCTGTGAGAGAGAAATCTGAGAATATTTTCCTGCTTTGTGGCCTTTAGACGCGGCTCAAGAACGCCACGCTGG
CCGTGCTGCGCAAGGAAAATGCCGCTGAATTGAGCGATGCGGGCGGTCAGCAGGCGGTTTCCAGTCAGCAGCCAGGGGCGGAGGGCTTGGCGGCGGTGAC
GCTGCCCAGAGAGCAGCGCCAACAGCTGACCGAGCGCGATCCTTGTGTCGGCGAGCTCTGTGCGTGGTTGCTGCAGCTAAAAGGCGTGGTTAAAGGCGGG
TACTGATGTGTTGGTGGTGTTGGTGTGACTGCAGGCGTGGCGCTGGAAGCGTGTTTGGTGCTGGGACTCAAGCCGCGCAGCACCGAGGAGCAGCCGTCCT
GGTGGCACGTGCTGTACGCTAGCACGCTCATTGTGGACGAGCCGACGTTGGTGCAGAGTGTGTTGTCTGCCGCTTTCCTCTCAGAGGTGAGTGTACGGCT
TGAATGGGATCGTGGAGTCGTGGTGGTCGGAGTGTATTGATTGAGTTTGTTGGTGTCGATCTTTTAGACTGATGCAGGGAAGGCGCGCTGCTGGTTGAAG
ATTGCGCTGAACAACCACACCATTGAATCGAGTATAATGGTAAGCCCTGATGGCTTGTGCTACGAACGACTTGCAAGTTGTTGACGGTTTGTATGATAGA
TGATCTTCTCCATGGCGTGTGAGCACTTGATTCGCAACAATTACGAGGAGTGGTCACTAGTTCGTTGCTCGGAAGGATTGGGTTTGTTTCTTGAACTGGT
AATTGCTCTTCGAGATGTGCACTTCGCTATTGAAGTTAGTGGCGACCCATTTCATTTGCCGGAGCCAGCGGAGGCGGTGGAAGTGGAGCCCGTTGCTGCA
GAGAGCAGTAGTGGAGAGATGGTTGCCACAATTACGGATGCTGATATCGCTGCGGCAGTGGGTGTGTCGCCTTCCAGAGCTGGTTCATTTTTACCGCCTC
CAGATACCGAACCAGTACTAGTCGAGATTGAAGATGCAGTCGAAGTAAAGGAACCAGAGATTCAAGGAGCAGTCACTACAATTGAGGAGGAAGAGGAAGA
GGTTATCCAGTTGCCATCCGCCCTTTTTCCACATCGTCTCCGGGGAATCAAACCATGGCAGTACGTTTTCGGCGTCAGCCTGGCTTCGCTGTCGAAGAAT
CCGTACCATAGCCGCTATGCCTTGATTGACCCATTGCTTGCCCTCCCCAATATCGTGAACGATTGTGTTGCGATACTGAGAGAAAACCCGGATACTCCCC
GGCTATTTCGTACGACGGTACTGAGTATTCGTCTTAACCAGCTTCGAGAAATTGTGGAAACTGAGGGATCGGTACCAAAAGATCTGGATCCACAATGCGC
AGGAGCACTGCTCTTAGACTTCCTGAAAAATCTGCCAGACTCTCTGCTGACGGACGATAAATATGATGCTTTCGTAGCAGCCGGACAGCTACGAGATGAA
GAAGCTAGCATTCGCAACATCACATGCCTAGTGAACGACTTACCTGTGCATTGCCAAATTGTGCTGAAGAGATTGATCAACCTCATGCACTTCTTGCAGC
AGCCAGAGCATTCTGAGCTGAATGGAGTGGACATTTTTACAGCCTCCAGCGTTCTAGCTCCTGTAATTGCATTCAAGAAAGACTCTGGAAGTGGTTTGCT
GTCCGAACGTCAGCGCGGTAGAACCCACTCCCAGTACCAAGATGTTCGATATGCAGCAGTGGGTGCCCAAGTCGTGGAGCGGATGATCCAACACTATGCG
ACCATTTTCCACACTGTCCGGGTCCAGGTTGTCGACGCACTTGAACGCTTGGAAGCAAAAAAGGAAGTGCTGCGGATGGTTTCTCATCAATTGAAGCTCC
TACCACAGATGAATTTCATGTCTGATAGACAACAAGTGAATGAGATTACTCGGTTGTTTCGCGATAATTTGGAGGAACGCGAGAGTTCCGCTCAAAATTT
GCCGAATAACTCTGCGGCTGGTCAAGCTATAGAGTGCTCGAAACCAGATATTGCAGCGGTAGTGGAGAATGAATCACAGTCAAATGTTATCAATTTGGAG
CTAGATCTGCGGGGGTCGACAGCTGCAACTCCACCCACCAGTGCAACTAGCAGCGGGGCATCTTCTCCGACAACGAGCGAAACGACAGAGCTAGAACCAG
TGAGCATCTGGGAACAATTTGGGTTCAATCGACCGACCATTCTGGGAAATTTTGAAAAGGGTGGCGTGCTCATGCTGCGAGCTATTTTATACTGGCTGAA
AAATGACCCGAACACGCTAGCGCTGCTAAAGATGCGAGCTCTACCATCTGAACTGCCGTCTTACGACGCGGGGCTGGTGGCTTCATCAATCTGTGAAGCA
TTGGTGAAGCTCCTGAAGCTATTGTACGTGATTTTTATGTGTGGCTGAGTGATGTATTTGCCAAAGCTGATTTCTTTTTATGTATTCCTTTAGCTTGACA
CCAAAGCATCCAGAAATCGATATTGTTGCGCTGTCCTTGGAGCCGTTCTGGGAGCTGTTTGACGAAGACATGTACTTCAACAAGTTGTTCATGTTCATGT
TCCAGGTGTTTGACCAACTCTGGAGCGAGCTTGACCCAAAGGCAGCGTCATTTACCCGCGTGATAACGGAGACCGAAGGGATCATGAACGAGTTGCTGAA
GAAGGCTCCTGTCACCGTTAACGACCTGCGAGCAGAATGGGCAGAAATAAGAGCACGTCGCCTGGAGGAGGCTGAAGATGAGGACGAACAAGAGCAAGAA
GAACTGGTAGAAGATGAGGCGCTCCAGGCTGCAGCACTTTCAGACCCATCGTTACTCACTCCTCCTTTGAGATACTCAAAGAAGAAACCTTCATTCGACG
TCAAGCCAGACGACTACAAGTCAAAGTTGATGGATACGTCAAGCATTTTGACTCTGGAACATGTTGCCTATATTGACCACGCGTTACCAATTACCAGTCA
ATTATGCCGATGGTTTCGAATCTACAGTATCGAAGCAAATGGATCGTCGTTGGAGACGCTGTTGATTCTTGCACAGAGGCAGAGCCCGACGTTGTTGGTA
GTGAAGGATGCGGAGGGAAATGTGTTTGGCGGATTTGCTTCCGACGAATGGCATCGCGCGTTTCACTACTATGGCACCGGAGAATCGTTCCTGTTTTCCT
TCTCGAATGCCAGCACTGCGGGTGGGTTTATGAAATATCAATGGAGTCGCAAGAACAGCTACTTCATGCTCTGCTCGGACGAGTCCCTGATCATGGGAGG
CGGAGGCAACTTCGGCTTGTTCCTGGTAAGTGTTTGTTTGAGTTCGATATACGGGAATCGATCGCTGTTACTAACTTTTCTGCATTCTGGCACATCAGGA
TAGCGATCTGTCAAGGGGGACGAGTGGTGCATGCGAAACGTACAATTCACCTCCATTGACGACTTCGCAAGAGTTTACGTGCGTCCACGTCGAGTTGTGG
GGCTTCACAACGGGAGACAAGCCCGACATCGAACGACACAGGAAAAGTGTATTGGACTAG