Transcript Name :
Phyci_75501
Orientation:
(+)
Number of Exons:
2
Description :
syntaxin 7like protein putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Target SNARE coiled-coil domain14.188PS50192
HmmSmart predictionP-Valprediction_id
Target SNARE coiled-coil domain3.7SM00397
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-247
271-271
248-270
NN-scoreoddsWeighted Score
0.6591.2520.003
*** None ***
TypeScore
nuclear348
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        898 bases(100 bases per row)
ATGGGCGACCGGTACCGCAGCGCGCACTCGCCGCGCGACAGCAGCAGCGGCGTGTCCGACGAGCGCTTCAGCAAGCTCGTGTCGGAGACCAGCAAGGGCA
TCTCGACCTTCAACCAGCTCACGCGCAGCATCGCGCAGAAGATGTCGCTGTTCGGCACGCCGCAGGACTCGCGCGCCAACCACACGCAGATCACGGAGCT
CACGGAGAAGGGCAACAAGCTCGTGGCCAAGATCAACCGCCGCCTGCAGGAGCTCAACCGCGGCGCCAAGGGCCCGAGCGGCCGCGTGCGCCGCACGCAG
ATCAACAAGCTGTCGGCCGACTTCAAGAACCAGGTGCGCGTGTTCGAGGAGACGTGCGAGCGGCTGCTCGAGTCGGAGCGCCAGTCGGTCGAGTTCATCC
GCCGCTCCTCGCAGAGCTTCAAGGGCGGCGACGGCCGCCAGACGCGCGGGGGCGCCGAGTTCACCAACTACAGCGAAGACCAGATCTACGCTCAAGCTAA
CGTGGTCATCTACGACGAGGACGGTGCGTCGCCTGCCGCTACTCGCTACATTCGTGGTTGTTGTGGGCTAACTCGTGCTTTGTGTCAATGTTGCGCCCGA
TGCAGATATGCAACGGAGAGAGGACGACATTATCCAGATCAATACCCAGCTGCGCGAGGTGAACGCCGCCTTCCAGGAAATCGACGGCCTCGTGCAGGAC
CAGGGCGAGATGGTTGTGGAGATCGTGGAGAACACCGATACGGCCAAGGACAACGTGGAGAAGGCACTGGAGCAGGTGAAGCAGGCTGACGAGCGCAGGA
AGTGCTGCGCCTGCTCAAAGATGAAGCTCATCTGTATCGCCATTTTCGCACTGCTTATCTTCATCGCCGTCATGGGTATCATGTTCGCTGCCAAGTAG