Transcript Name :
Phyci_297222
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein THAOC_16293
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Heat shock protein 70 family4PR00301
Heat shock protein 70 family4PR00301
Heat shock protein 70 family4PR00301
Heat shock protein 70 family4PR00301
Heat shock protein 70 family4PR00301
Heat shock protein 70 family4PR00301
Heat shock protein 70 family4PR00301
Heat shock protein 70 family4PR00301
Heat shock protein 70 family4PR00301
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Heat shock protein 70 familyIPR013126
Y-scoreD-scoreY-pos
0.5780.69921
InsideOutsideTMhelix
1-659
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K09490
K09490
K09490
K09490
*** None ***
Sequence
        1983 bases(100 bases per row)
AGGATGAACCTCTCCAAGATCCTGTTCATGGCGGCGGCGGCCTTCGCCGGCGCCGTGGTGGCCGAAGACGCCAAGGGCCCGCGCGGGCCCGTGATCGGCA
TCGACCTGGGCACGACCTACTCGTGCGTGGGCATCTACAAGGACCAGAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGTATCACGCCCTCGTACGT
CGCGTGGGACTCGAACGACGAGCGTCTGATCGGCGACGGCGCCAAGAACCAGGCCACCATCAACCCGGAGAAGACGCTGTTCGACGTCAAGCGCCTCATC
GGCCGCAAGTACAACGACAAGTCGGTGCAGGCCGACAAGAAGCTGCTGCCCTACCTCCTCGTGAACAAGGACGGCAAGCCCTTCATTGAGGTGGAGGTCA
AGGGCGAGAAGCGCCAGTTCGCCCCCGAGGAGGTCTCGGCCATGGTGCTCACCAAGATGAAGCAGATCTCGGAGGGCTACATCGGCCGCGAGGTGTACGA
CGCCGTCGTGACGGTGCCCGCCTACTTCAACGACGCTCAGCGCCAGGCCACCAAGGACGCCGGCACCATCGCCGGCCTCACGGTGCAGCGCATCATCAAC
GAGCCCACGGCCGCCGCCATTGCCTACGGCATTGACAAGAAGTCGCAGGGCGAGAAGAACGTGCTGGTTTTCGACCTGGGCGGCGGCACCTTCGATGTGA
CTCTGCTGGCCATTGATGGCGGTGTGTTCGAGGTGCTGGCCACCAACGGTGACACGCACCTGGGCGGCGAGGACTTCGACCAGCGTATCATGCAGTACTT
CATCAAGAAGTGGAAGAAGGACAAGAACCTCGACGTCGCCTCGGACAAGCGCGCCCTGCAGAAGCTCCGCCGCGAGGCTGAGCGTGTCAAGCGCGCCCTG
TCTGCCCAGGCCCAGGCCCGTCTCGAGATTGAGTCGCTGCTGGACGGCGAGGACTTCACCGAGTCCCTGAGTCGCGCCCGTTTCGAGAAGCTCAACGAGG
ACCTGTTCAAGAAGACGCTCGGCCCCGTCGAGAAGGTGATGAAGGACGCCGACCTCAAGAAGTCGGAGGTTGACGAGATTGTGCTGGTGGGCGGCTCCAC
CCGTATCCCCAAGGTGCAGCAGCTGATCAAGGACTACTTCAACGGCAAGGAGCCTTCGCGCGGTGTGAACCCCGATGAGGCCGTCGCCTACGGCGCTGCC
GTGCAGGGCGGTATCCTCAGCGGTGAGCAGGACGACCTGACCAAGGACGTGCTTCTGATTGATGTGGTGCCTCTGTCCCAGGGTATTGAGACCGTGGGCG
GTGTCATGACCAAGCTGATCAACCGTAACACTGTGATCCCGACCAAGAAGTCGCAGACCTTCTCGACCTACCAGGACAACCAGCCCGCTGTGCTGATCCA
GGTGTTTGAGGGTGAGCGTGCCATGACCAAGGACAACCGTCTTCTGGGCAAGTTCGAGCTAACTGGCCTGCCGCCTGCCCCGCGTGGCGTGCCCCAGATT
GAGGTGACGTTCGAGATTGACGCCAACGGTATCCTGCAGGTGTCCGCTGAGGACAAGGGCACGGGCAAGGCCGAGACGATCACGATCACTGCCGAGAAGG
GCCGTCTGTCCCAGGAGGAGATCGACCGCATGGTCCAGGAGGCTGCTGAGTTCGCTGACGAGGACAAGAAGGTCAAGGACCGTATCGATGGCCGCAACGC
TCTGGAGGGCTACCTGTACAGCCTGAAGAACAACGTTGAGGAGAAGCTCGAGGACAAGATCGACGAGGACGACAAGGACACCGTTCTGACCGCCGTGCAG
GACGCCATGGACTGGCTCGAGGACAACCAGGAGGCTGACAAGGAGGACTTCGAGGCCAAGCAGAAGGAGGTCGAGAAGCTCGTCAACCCCATCATGTCCA
AGGTCTACCAGGGCGGCGCCGCCCCGGAGGGcgacgaggactacgacgacgaggaggaggacgacgaccacgacgaGCTGTAG