Transcript Name :
Phyci_60492
Orientation:
(+)
Number of Exons:
3
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
AWS9.971PS51215
SET domain19.502PS50280
Post-SET domain9.003PS50868
Zinc finger, PHD-finger9.098PS50016
HmmSmart predictionP-Valprediction_id
AWS0.0013SM00570
SET domain8.4SM00317
Zinc finger, PHD-type4.7SM00249
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Post-SET domainIPR003616
*** None ***
InsideOutsideTMhelix
1-817
NN-scoreoddsWeighted Score
0.7634.9710.01
*** None ***
TypeScore
nuclear913
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
nucleusGO:0005634IEA
KO ID
K11423
*** None ***
Sequence
        2596 bases(100 bases per row)
ATGCCTCCGAAGCAGGTTGGGCGTCCGCGCGGCCGCCCCGCCGCAGCCAAGAAGCGCAAGCTGGAGGCCGCCGGCGACGAGCCCAAGGTGGCCAAGCGCG
GGCCCGGGCGACCACCCAAGAAGAAGCCCGTGCTGGTGGCTGCCGAGCCCGCCCCGGAGCCCGTGGGCGAGCCGCAGCCCGCCGTGGACCCGGAGACCAC
GATCTTCCTGCAGCTCCTGGAGGACGACAcgcggcgcctgccgcccccgcccccgccgcTCCCCAAGCGCCGCGGATCAGCCAAGTCCCCGCCCGAGAAG
CGAGTGGTGGAGTTCCAGCTGCCCTTCAAGGAGGCGGAGATCAAGAGCCTCGAGGAGCGCCAATGGGTGCGCCGCCCGCCACCCTTCGGCAGGATCAGCC
GCTGTGTCTACGTGTCCACGACGATGCCCATCGCCGACTTCCCCGTGCACAAGTGCACGTGCTGCGAGGAGACGCACAAGTCCATGACCAAGCGCACGAC
CATGATGGCGAGCGCCAAGGCCCAAAAGGAGCTCGAGACCAACGGGGCCCACGCCGGCGTGGACAAAGAGAGCGAGGCGGAGGACGTGGTGTACTGCGGC
GAGGGCTGCTACAACCGCATGCTGTTCATCAGTTGCTCGGACGAAACGTGCTCCGCCCCCGACCCGAGCATGTGCAGCAACCGAGCTATTAAGAGGAGGG
AGCTCAAGTCGGTGAGGGTCGAGTACATCCCCGGCCCCGGGTTCGGACTCATCGCCAACGAGAAGATCAACGCGGGAGAGTTCATCATTGAATACGTCGG
CGAAGTGATTGACGACAGCGAGTGCGAACGCAGGCTGATCCAGTACAGGGACAATGGCGAGGTGGGTGTTTGCGAATCGTAGAGTGGGTGTTGTGAACCG
ATGCTGACACGGGGTTGATTTGTGCTGTTAGGTGAATTTCTACATGATGGAACTCGAGAAAAACATCGTGATCGACGCCAAGTACCGCAGCAATGACTCA
CGCTTCATCAACCATTGTTGCGATCCTAACAGCGTGACGCAGAAGTGGTATGGTGTTTGCTTTGGTCACAACCAGCTGAATCAGCGATGTTTCTAATGTG
TTTCTGATTGTGGCAACAGGAATGTGGATGGTATTCAGCGCATTGGAATCTTCGCGCGTCGTAATATTGCTCCCAATGAAGAGATCACGATCGACTACAA
CTTCTCCCATTTCGGTGAAGCTGCCGACTGCAAATGTGGATCCACTGCATGCACTGGCAAAATGGGTCTTAAGCGATCGAAACTGTCCTCGTTCAATCCT
CGTGTGGTGGGCACTGCGAAGGCGAAGAAGCAGGTTCCCGTGGATGAGAAGCCACCCGAGCTTAAGCGCCCCGTGCACTTGACATCTCTGGCGCTGCTCA
AGAGCTCACAGATGGACGAAAGCTGGATGGATTATTATGGGTTCAAGACTCGCCGATTGTTCCTCAGTCATCGACCACGCCGGCAGAAAAAGGTGGGCAA
TAATGAAGTTAACAACGGCGAAGTTCGTACTAGCCTGCCATCAAGCAGCCCAGCCTCCGAGTGCTCCACAACGACTGAGGAGGATGTATCACTGACACCG
CCACAAGCTGTTACGAGTAACCTTGTCGAAAAGCGACCACAAAGAAGCGATTGGTACGAAAAGGTCATAGCAGGGGAACACTTGGCTGAGATGAGAGCAC
TACACAGCTACATCTGCGGAGGCAAGTCAGACTGGTCAGAAGATCTCAAGGTCGATCTAACTGCGGCAGAAGTGGAGGTGAATTCTCCGTCGCCGATTAA
AAAGAGGGGGCCAGGCCGTCCACCAAAGAAACGCGGTCGTCCGAAAAAGGTGGGGCCTGCGTTCGTTCAGTCTAAGCGTATTTCTACTGGGGCCAAGCTT
ATCCATTCAAGGCTGGGTCTCTCCCAAGCGCGGGCAAGAGGCATATCTGAGCTTGCGGCGTTTGCAAATGGCAAGTCGAAGTGGAACAAGCGCATTCCGT
CGTCCAGCTCTATCAACCCGGACCGAATTCATCGCCTTATCGATCGCGTGAAGGGCAAACAGATCTATATCAAATCTGACCAGGTGCGTCGTTTGCTGAA
TTTCTGTGACATCGAAGTAAATTTCACTGACTCGTACCATGCCTTCCTATTACAGAATGACCTGAACGAAGATGCTTGCTTCCGCTGCGGCCTAGCGGGT
GAGCTCATTTGCTGCGATGGGTGCCCTGCTGCCTTCCATCTCAACTGCACCAACCTCGCCATGGTGCCCCCTGATGGCATTCCATGGTTCTGCTCGGAGT
GCACAAACCCAAGGCACCTTCAGAAGGCTTCGGAGACGTCCGACGCAGGCCTCATTGCTGCTAACGGTACAAGAAGCAGCAATCGCGCCAAGCACACCGA
CTACGCGAGCCGCCACCTGCGCACCCACGGGGCTCCGCAGATCCCAAGCCTCAAGAAGATCTTCCACTCCTCAGTGCCTCATGCCAAGCGCCGCTACAAG
AAGCGACATAAAGCCACGGACCGTTCCTACCGCGAGCTGGAGCACATGCCGCTCCCTGTGTGGAACGAGAGCGACGAGAGCGGAGCCGAGCAGTAG