Transcript Name :
Phyci_206273
Orientation:
(-)
Number of Exons:
11
Description :
protein kinase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain21.588PS50011
EF-hand domain14.653PS50222
EF-hand domain12.923PS50222
EF-hand domain14.29PS50222
EF-hand domain13.481PS50222
HmmSmart predictionP-Valprediction_id
EF-hand domain0.0023SM00054
EF-hand domain0.0012SM00054
EF-hand domain4.7SM00054
EF-hand domain4.2SM00054
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-510
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
calcium ion bindingGO:0005509IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2531 bases(100 bases per row)
ATGCGGCTTATCACGCGCCTTACGCGCGCCCCCGTGCGCTCCAAGGTGGCGCCCACAGCAGCAGCAGAGCATCTGCCTATAGCCAAGCCCAAAGAGGCTG
CGTACGGCAATGGGACGGCCTGGGTGGGCCTCGTGACGACTGCGGCGGCGCTGAGCGTCGCTGTGCTGATGTCCCGCGACACCCCCGGCAGCGACGTCGA
GTGCGGATCGAGCGGTGGATGGTGGTGGACGAGCCCCAAGATGGAGAAGCGAGGACACTACGCCCTGCGGGAGGAGCTGGGGCGAGGAGGTGCGACGAGT
TCTTGAGAAGTGTGGAAGAGGACTGGTAGAAGGATAATGGGTATTATTTCTGCTTGGTGGCGTGAAGGGTTTTCAATTGTCCGTCTTGCTGTTGATATGC
AGACTGATGAGGTAGGGAGTTGACGAGGGGAAGTGTTTGAGGTGGAGCAGCTGATGCTTTTTGGATTGACTTTGGTAGAAACTGGCGGCGAAGATTTTTG
ACCCGAAGAGTTCGTCGTTGGAGACGATTCAGGCCGAGGTACAGTATGTCGCTGCGTGACCGAGTCGTGCTGGCGGTGAAGGATACTCATTGAACTGTTA
TCGTCGTCTGTAGATTGATACTCTGCGGCACCTGGGCACACATCGAAACATTGTATCGCTGCATGATGTGCTGTATCTGAAGGACGAGACTATTATGCTA
ACGGACTTGGTCGAAGGAGGCGAGCTGTTCGACTACATCGTTGATATGGTTGGTGGAGTCAATATTTGCTGGAATGGAAATACAGTGTGCAAGCGAATCA
ATGTTACGGCGTTTCGTATTTGGTGAGATAGGGGTCAGTTTCGGAAAAGGATGCCGCTCATCTACTTCATGATGTCTGTCGGGCGCTTGATTACGTGCAT
TCTCGTGGTGTCTGGTGAGTTTTCATAGCTCGGCGGACAGTTTTCGTTTTTGATCGCGAATGCTAACCATTTCTGTTTTCGTTAATAGCCATCGCGACCT
GAAACCTGAAAACGTCTTGTTGTCAAACCGATCTGCGAATGCGAACGTCAAAATAGCGGTACGAAAGTTGCATCGCGTATTGTAGCCGACCTAACATTTT
TACTAAGTAGTTTTAGTCGTCGTTTCGTTTGAATAACAGGACTTTGGATTAAGTCGGCGTCTACGACAGGGAGAGCAGATCGTCGAGAAGTTCCCAAACG
GAACTGTGTAAGTATGGAACGAAACCTTTCAAATGATGGAATTTTGACGCTAAAAATTGCAATTGGGCAGCGCGTATTGGGCCCCTGAAATCATCACGCG
CCACCCCCAAGACTTCAGCGTTGACATGTGGGCATTTGGTGTGCTGGTATGAACTGAGATCAAGTGATGAATCTGCCTTCCTTGACTGATCATTTACCCG
CGTACGGCTGCGCTAGGCTTACATCACATTAACTGGAGTGCATCCGTTTGATCCGAGAGGTGATAAATCGGACGCTGAAATTGTGAAGGAGATTGCGAAT
GGGAAGTACGATGGTGCGTTCAATTACCCATTGTTTTGGCTTTTGGCTAAAGACTTACGGGGAATGCTTGGGTGCAGTGGACAACAAGTGGTTCAAAAGC
CTATCTGCAGATGCCAAGGATTTCTTAACGCGGCTATTGGATTCTGACTCGTCCAAGCGACTGACAGCGAAACAAGCGCTGCAGCACCCATGGCTCAGTG
GTATCACATCGCCCGAGGATCCGCTTGACGCTGGCCATAGTCACCGACTTCAGTCGTATCAGCGACTTCAACAACTTCGTGCCAACATTTTGGCCGTCAT
CATGGGCGTACAGCACGCGAAATTGGGCGACACCCCTGGTGCCGGTGAAAAGCACCTCACGTCGCACAGGACGTCGACTGTTAATATGGACATGTTCAAA
GAGACGTTCGCTCTGTTTGACAAAGATGAATCGGGCTGTATTGATCGAGATGAGCTGAGGGGCATGCTGTTAGCCCTGGGCCAGCAACTCTCTAGGTACG
TTAGCCAGTGTTCATTGTATAGGCTACCAAACCAGCTAACCCGTCTACGCTGTGAATCTGTGAGCTAGCTCGGAAATTGACTGCATTATGCGCCAAGCAG
ACACGGACGGCGACGGGAAAATTTCCTTCATCGAGTTTGTAAGCATGATGAATCAACGGCTTTTCCGTCGGTACGTGGCAAAGTTGTCAGCGGATTCTTG
ATAATTTTTCTGATAAGCGAGTTTTCACAGTGGCGATTTGACGGCTGGAGATCTCAAGGCTGCGTTTGACGTACGTATCTGCTAAGGATTTCTGTTTTTC
ATGTTACAAAATAAACGGAGCTGACGCCCAACCTTTCTCCAGACGTTCGACGTGAACCGCGACGGGTTCATTTCAAGCAGCGAACTTCAACACATCCTTC
ACGTGCTGGGCAACAAGCACATCAGCCGCGACGAAATCTGCAAAATCATTCAAGCCGCTGACAAGAACGCGGATGGCAAAATTGACTACGACGAATTCTG
CGCCTTGATGCAGCAGCAGACGAAGGGCTGA