Transcript Name :
Phyci_206139
Orientation:
(+)
Number of Exons:
9
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain40.259PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain1.4SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-486
NN-scoreoddsWeighted Score
0.5491.5430.003
*** None ***
TypeScore
nuclear435
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
KO ID
K06633
K06633
K06633
*** None ***
Sequence
        2037 bases(100 bases per row)
ATGCGCGCGCGGTCGCTGCACGCGGCGCTGGAGGAGGCGTCCAAGGCCTCGTCCCCGTGCGTGAGCAAGACGCTGAGCTTTATGAACAGCGACGACGACG
AGGAAGAAGAAGAAGGCGCCGGAAGCGCTGAAGAGGCCGCAGTCGACCGTCCGGGGGGCACGTTCCGGCACCGCACGCGTCGCCTGGAGCGCCTGGACGT
GTACGTGAGGCAGGACCCGCCGTACCGTCGCCAGGCGCTGCAGTCGCCCAGCAACGCGCTGCAGCGCCGGTCCTGCTCGGCGGAGCAGACCACGCCCACG
TCGCATCGCAGACACAACCTTGTCAGGAGGTCCGTTTTTCGCTCGGTTGGAGCTGGAGAAGAGGGAGTTGAAGCTGATCAATTGTTGGGGGTTTGATGGG
AGCAGATGCAGTCGGTCGGCGTCGCCGCCGTGTGCGAGTCCAGCGACGTTGTTGAGCCATAGCCTCGGATCTACGCTGTCCATGATGAGTCCGGTGAAGG
GGCGAGTACGTCCGCAGCTGAAGAAAGTGGTGCTCAAGAGGCTTAGTGTGGCAGGGTGCTCGGTGGGTCTTTTGATGCCTGGGGGTGTATGGGGAGTGGG
GGCGGCTGCTGATTTGTGGTGGGTGTTCTGTCGTGCAGAAACACTTCGTGACTTCCTTTGAGAGCCTGCAGACGCTTCGATGGCTCGGAGCTGGTGTGTC
GGCGGAAGTTTACAAGGTATGACTGTTGTATAGGATCAGATGTGCCGTGGGTTATTGACGAACTTGTGTTCGTTTAGGTCCGAGACCCGGACTGTGGAGA
GCTTTTCGCCATAAAGAAGTCGAAGGCAGAGCTACGGAATGACCGAGAGCGGTACGGTGCTAGTGTGAGCTCTTTGCAACGTTGATGATACCTACAGTAG
TGGTCTAATAATCATGGTCTAATACTCATGATTTATTATTCAGAGACCTCATGACCCAAGAAATCACCGTTCTCGAAAAGCTGGCTGCGTCTGAGCACAA
CTTTGATAACATTGTGCGATATTATCAGGCGTGGCAAGAAAACGGTAAGTTAGGCATCGAGTGTGATGCGATGGTACTGTAGACATATTTGCTGATCAAT
GACTTGGAGTACATTGCAGGCTTTTTCTACTTGCAAATGGAGTTGTGCGAAGGTGGCACGCTGCACGATTTTATTACGATACGGAATCGGGAGGAAGCTC
TCCCCGAAAACTACGTGTGGATCGTTCTAAGGCATGTCGCGAGCGGGCTGAAGGTGCTGCACGAACACGATATCGTTCACCTGGATGTGAAACCCGACAA
CATATTTATCACAGAAGACGGTCGATTAAAGATTGGTGACTTCGGCATGGCTGGAAAAGTGGTGACATCCTCCGGGATGTCAGGTCAAATGAGTGATCTC
GAAGGTGATGCCAAGTACATGGCGAAGGAGTTGCTGTCCACAGCAGAGCGACTTCCGCCTGCAGATATCTTCTGTCTAGGTACGTTAAAGCGCAGCGGGG
CTTTGCGAAAGTGGGTACTAACGCAATTTGTTATTTTATAGGCATCACGATGCTAGAAATTGCTACGGGAGTGGCATTACCAGAAGCTGGAAAGGAGTGG
CACGATCTTCGTGAAGGAGTCCTGCCATCATTTTCTCCTGAATACTCGGAGGACCTTAGCGCATTGATTCGACAGGTACGACACACACGCTCCGATGTTA
CCCGCATAGTTCCAAACTAAGCTCGTGTTGGCCGAGTAGATGATGGATCCCGATCCAGCGCGCCGACCCAGCGCAGCAGCAATCCTGCAGAATCCCCGCG
TTCGGGCCGCTACGGAACCTGCTACTCTCATCATCGAGGTTTGTGCTTGCATCTCGCATATGCTCTCCACACCGCGTCGCACCACTGACGCTCCCTCGTT
GTTCCGTACAGCACGCTCTCAAGCAAAAGCTGGTGGTGCCAACCAAGGTGCGCAACACGCACCGATCCGCAAGAAACAGTCTGCAGACCCCGCACAAGAT
CCGTCCCTCGTCGTCGTCAGAGCCCAGGTCTCCTTGA