Transcript Name :
Phyci_262042
Orientation:
(-)
Number of Exons:
5
Description :
Drug/Metabolite Transporter (DMT) Superfamily putat
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5270.67125
InsideOutsideTMhelix
1-40
106-134
187-198
287-292
343-431
64-82
158-166
222-263
316-319
41-63
83-105
135-157
167-186
199-221
264-286
293-315
320-342
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2099 bases(100 bases per row)
ATGGACGTGAAGCGGCTGCTGTGGGAGTCCAAGCTGGCGGTGGCGCTGTGTCTGCTGATCATGGCGCGCTGCGTGGACCGCGTGCTCTACACGTGCGTCT
GTCGCTAGTAGAAGATGGAGTGCTCTTGCTGCTTCGGTCCCTCCCTCACGTTGCCTTCGACGCTCATGTGTGTAGACGAATCACGTACGACTACACGGAG
TTCCTCTGGTACTTCACGAACATAATCCTGCCTATCGCCTTCTTAGTGTCCTCGGCTCCTGTGGTGGCGTACGTGGCGAATACTAGTGAAATGCAGTGAA
TGCCGTCGCTTGCGGGGGCTAATCTAGTCGTGTGCTGTTGCTGTGGGATAGATACAAGCTCTACTTCACGGGTGAGCAGGCGGAACTGGGCCCCTCGAGC
CTCTGAGGGTGACAAGCTGATGGGTTTGTTGTCACATTATGTGCAGATGACATTACGCCCGAGATGCGCGAATTCCCGCACTACAAGTACATGCTCATGG
CGCTGTTCGACACGCTCTACAACCTGCTGGGCGCGTTCCCCACGCCTCACATCGGGTGCGTCCGTTGAGCTGCTGGGTACAAAATGCAGCGGAAAACTCA
CCGTGCTCGTTGATGTGCTGGCAGGGGGAACATGGCCAATGTGCTGAACCAGCTGAACCTGCCGTTCAACATGCTGCTGTCCTACATGTTCCTGCAGACG
CGCTTCAAGCGCGGCCACATCCTGGGCTCCATCCTGGTGCTGTATGGAGGCATGGTGAACATGATCCCAGTGCTCACGGGCCAGGACAGCGCCAACACCC
CGGACCCGAGCGCGGGTTGGATCATCCTCTATATTGTGTCGCTGGTGCCGGCGGCGGCGTCGAACGTCTACAAGGAAATCGGACTCAAGGATGTGGATTT
GGATATCTGGTACGCGAACATTTGGATTAGCTTTTACCAGCTGATCATCGGCTTCGCCACGATCTGGACCGTGCGTATCAAGGCGTTTAGCGACCCGCCC
GTGCCCTGGGCGGACTTCCCGTCCTATGTGGTCAAGGCCCACGAGTGCTTCATGGGCAACGAGGTCGAACTAAACGGAAAGGCGCTGCCCTGTGACTCGG
GTGTGCTGGAGGTCTTCCTGGTCTTCATTGTGTTCAACACCATGTACAACCAGCTAATGCTCTACATCTTCAAGGAAGGCAGCAGTGTGCTCTTCGTGGT
CTCGTCCGCCGTGGGCCTTCCGCTCACCGACCTGCTATACATGATCCCGTTGCTCACGGGCAAATTCGCTGGCCAGGCTTTCACTATTTACGATGGCTTC
GCGCTTTTCGTGCTCGTGATGGGCTTGCTCGTTTACCATTCCGAGAAGGAAGAGCGCAAGCGTGGCACCGAGTCGGTGGAGAAGTCGCCCATGTATGCGT
CGCCTTCACTGCAGAAGACGCACCTTATGCGCAAGCGCCGTGGCAAGGTGGTGTACCGACAGAGTCCCATGATCCGCCGCAGTGGAAGTGGCAGCGATAT
ATCGCAACGGCTTTTGGGCCGTAATGCCCCAGGCAGGAATAACACGTACGGCACCAACGGCAAACCTGCGGCGCGCCAAACGGGCAACGATGGTTATCAC
CCCTAAGCTTACGGTTCGTCTGCGTTGAAAGCTACTTCATGATGGTAGCTCATGGCCCTCTTCTTCATCCCGCTGAGCTGATAAATAGTGCAGCTGTTGC
TAGCCTCGCATTTCGCTTAAATAGAGGATTAAAAATTCGTCTTGGTTTGCGATGGAGAAAACCCAACCGAATGTTTATACGCGTCGGACGATAAAATCGA
GAAACTCGACAAGTTTGCGTCGGAGGTGACAATTCGACCTAAAGACGGGAAATACCGGTCCCCTTTCTTATCACGGCGCGCTTGAATATTTACGTAATGC
CCGAAGCGATCAACTTCCTGAGAGAAACCATAGTCGCAATCCTCTTCGTTAGGATGCTGCTCGTTTGTCTTTAGTTTTCGGGGATTCGTGGGACCACTAC
TCGAGTCAAACAATGGATCGAGCATTAGGTTGTACGCGGCGTCTTGATTTCGCCGTTTGGGCTTAGACTTTGGTCTTGTGAAGACGTAGTGATGATGAG