Transcript Name :
Phyci_88697
Orientation:
(+)
Number of Exons:
2
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Acyl-CoA-binding protein, ACBP2.1PR00689
Acyl-CoA-binding protein, ACBP2.1PR00689
Acyl-CoA-binding protein, ACBP2.1PR00689
Acyl-CoA-binding protein, ACBP2.1PR00689
Profile scan predictionP-Valprediction_id
Acyl-CoA-binding protein, ACBP43.968PS51228
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-88
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
fatty-acyl-CoA bindingGO:0000062IEA
KO ID
K08762
*** None ***
Sequence
        542 bases(100 bases per row)
CGCAGCCCCCGCCGAGTCCACCGCACAATGTCTGACCTCCAGGACCAGTTCGAAGCCGCCGCCGCGCTCGCGAAGACCTTCACCAAGAACCCCGTACGTC
TGTTGTCACTCTTCGTCTCTGTGCGCAGCGCTAGACGCAACTAACCGCGCTATTTCACCCTTCAGACCAACGACGAGAAACTCGCGCTGTACGCCTACTA
CAAGCAGGCCACTGTGGGCGACAACACGACGCCCGCCCCGGGCATGTTCGACCTGACGGGCAAGGCCAAGTGGAACGCCTGGACGGCCAAGAAGGGGCTC
TCCAAGGAGGACGCCATGACCGCCTACATCGCCGAGGTGGAGAAGCAGAAGGCCGTCTACGCCTGAAGCGCGGCCGCTCGGTCGCGTCTGTAGCTCTCTT
TCCCTCCTTCAGGGGGCGGCCGACTGCAGTGGCAATCAACGCAGAGATCGCTCTCTATACATGCAGAAGCTGCGACTGCTGTGTGAGCTGTGCAGGTTGC
CCAAGGGGAAAATGGCGACGATCGACCCAGCACCTGCTTCGG