Transcript Name :
Phyci_331428
Orientation:
(+)
Number of Exons:
4
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1491
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4879 bases(100 bases per row)
ACAGCAACAACCGCTGCGTGCAGACCAGCATTGAGGAGCTGGTCGCAAGCGCCTAAGTATGTATACAATACAGCATCATCTTGGTGAAACTGCCATTCCT
AACCCACAAGTGTTTTCGGTGCTGTGTTCATGCCGTGTTGATAGCAGTGAACCCTATTTCCGTCTGTGTCATCTGCCATGAACGAGCGCAGCTCGCGCCA
TGGCAAGCGCCGTGAGGTGACGTTGCCGTACGAGAAGGCCTATCCATGGGAAGACGAGCGTGGATCCACGGTGGACCGCACCGTGGAGGTGAATGCGGAG
GCCAAACGCGTGTACGAGATGCAGGAACAGTTGCTCCCAACGCTCGCACTTGACCGACCACTGGACCCCGCAGCAAGTGATCACCTCCAGGACGTGGGCC
GTCGTGTTTTGATCCTGCGTGACACGACAAAGCGGTCGCGCAAGAAGAATGAAGCGGAGCAGAGCCCGAAGCAGTCCCCCAAACGCGTGATCCCAAGCCG
ATTTCCTGAAATCACCCCTGACCTCGATGAAGAAGATCGAGGTGACCCCGATCGGGTGGAAGAGGAAGAAGACCCCGTGGTGACCGACGGCCGCATTGTA
CGTTAACAAGAAAGCTACTGGTCGAGCTTGTACGTTTTAACGTAGACATGCTTTTGGCTTTCCAGGCAACAATGCTGATGGACCAAGAATGGGATACCCG
AGGGTGGAATGCAACCAAAATTCAGACCGCGGTAGATACTCTTTATGAGGAGATCGAGCATTGCGAGGATGATTCACGGCGCGACCTCGCCACCACGATG
CTCCTTCGTCTGATGGAGACCCACGAAGGTCGGTACGTTAGCGTGGTGTAGTGGAAGTTGATGCATTTCTCCGACGGACATTGAAGATTACTTACAATTG
GCCATCGTGTTCGCGGTGCTACTAGATGCTGTGGACTACGTCGAGACCTCCTTACCAAGTTTGACCAACAAGGCGTTCCGGACACTCTCCAAACTCACGA
ACAACACCAAAATATTTCGCATGGCTCGACTAGTAGCAGTGCTGGCAGAGTGGTTTGCGCACGTGCTGTCCAGCGAAAACGCAGTCAATAAGAGCATCGG
ATGCTTGCTGCGCGAAACCGAGCTATGCGCGCGTATCCTTCAACACCACTGGCGTGGAGTAATTTTTGAACGCACAGTAAGTCAGCGCGACTATGATCCT
ATTGTACGAACCCGCCTGCGCTCCATGCACATGATCAAGTTCGTGGAGTTGCGTCACCAGTTTAAGGTGTTTCGAGAAGCCGTTGGGCCCGAAGGAGTTC
CAAGTAGTGTTACGCAAGCGTACATCACGATACTGTACCATTTGGTAAAGCTACAGCACGACCCTGACAGCAAATCTGGTAAGACACGCAACGCTGTGCT
CTCAGATCAGAGGCGGATTCTCGGCTCGGGCTTGCTGGTTTGCCTTGCGTCACTAATTACCAGACGCCAGAGCCGTGAAGTTATCGAGCTGGTGAAAGGA
ATTATTGCAAATATTGTTGAAGGCCACGGAGACGAGCAGATTGTGGAGATTCTCCAGTGCAATGTAGTGCAACGAGTTCAACTGGACTTGATGAGCACCA
TGGAAATGAGCTACAATAGCAGAACGGACGCTTCCATTGCTGCACTTACAAGCTCGCTAGACTTGCTGTTTTCTGTTTCGAAAAAGGTTCTCCTGGTGAC
AGAGCAGTGGGGTCACAAACATACTACAGCAACTATTCCGACTAGCCCTCTTCGGAGATCACCTAATAAAGACTACAACCGTGCAACAACCCCCGAGGAA
CGAACCTTCTTGATGCGAAAGTTGAAGGCCTCAGTGCGCACGTTCTTGCTTACTGCGGACGTGTTTGACACACTTTTCGAGGTTTTGTGTTACTGCCGAG
ATAAAGGAGATTCATTGCGAGCACAGACACTGGAAATCCTGTGTTTGCTTGCACGATCGCTAGGATTCTCCCAGCTCCTCGATGCGCTCACAAGATGCGG
AGGTCGGTGGCTTGAACAGGTTCTGCTGTGCATGCGAGACTCCAACTTGGTAGTTGTTCAAGCCGCCATGACATTATTTTACGAAATGACAAGTCGTACT
GACGCCCGGCATGGGCTTACAACTGCAGGGGCTGTCCAAATATTCATGCGCTGGTGCCGACCGAGTTTTGAGGCTTCTGAGTCGCGAATGGTCTTCATTA
TGGGGCTTATAGGGTGTGCACTACTGGCAAGACAAACGGAACAGATAAAGCCTGTCACTTCGCTGTTAGAGGCGCTCGCTACCTGTGATGATCGGCTGGA
TGCATTTTACACTCTGTTACTGGAGTTAGCACTCCAAGATGACTCCTGCGCGCATGCCTCGGAGAAAACAGCGGCTTACTTTTTCTCGGTAAACGCACTG
CCCACCATCGTACAATTCTTAACTCAAGTATCACCAAGTTGCATGGAGTCGCCTGTTCAGAACTCTCGACAGCGCAACATTAGCTGCATTTTGCTTGGGC
GTATATGCAAGGTCACGCTCGTGAATCGCGCGTGCTTTTCTGAGAACATGATCAACCACCTCGCACTTTCCATCCAGTGCAACCGCCTTGATGAAATTGA
GGGATTGGTCGCGCATAGCTCATCGGAAGATCGCTTCATCCACCACCTAGGATCAAAAGAAGCCTGTAAGGCTCTTAGTCGGCTCGCAAGATGTCCCAGT
AACATGGTAGACGCACGACTTCGACCTTCTATCACCTCCCCCCAAGTTCCAGAATGGCCTCAAGCTATGATTTGCGACGTCATGTTCCGGATGCATGTGC
TTGAAGACTTAATCGCGTTGATCCGAAATCCTAGTGACGCCACAGAGTTTGCGGAGGTGGAATTAAGCAAGGTCATTTCTGCAGTGGAGCTAGCGGGGTA
TATTCGCCCTTTGCCTTACGGTGAGAGCTCTCGAGGTAAGTTTCTCAAGACGCACGCAAACCATCCGCATGGGAAATATTCGCAAGAAAAGCTTCTTCAG
TTGGTTGAGCTCATTGCCCCAGCCATTTTGCACGTTCTGCGCGAGAAAAGTATCAGCTTCGACCTTGTTAGTGCATGCTGCGTGACATTGAGTCGGTTAG
CCTGCACCAATTCTGCTTGTAGCTTATTGCTCACTCAAGGTTGCTTACAGACAGCGTTGATTCACCTGCCCGAGATCCTGATCTCGACTACAACTGGGAA
GTCTTCTCCGAAGAAACAAAGTGTCGAGTTTGATTCATCTGTTGATGACCATGGGCTTCTGGATGTGCCTGCTGCACTCTACACGCTCTTTGGCAAACTC
TGTGCAGTCGCAGACGGCCGAACAGGGATAATGCGTGCTCAAGTATTACCTCGACTTCTTAAGCGTATGCAACTGCGACATCCTGCGTCAAGAGCTTTTG
ACGATGAATGCAAGAGCGAAATTGCTGTCGTTATCGCACATTTGGCCATGGTGAATGCCGTTGAGGGTAGCACAAGTGAACTCTTTTTGCACTTCCGAGT
ATTAGAACTACTTGCAAAAATTTTGCAACAGCACAAGGATCTTGTTCTCGCTGTTGGTACCGTGTCATCATCCACAAAAAAGAAGGAAGAGCTTAAGAAA
TGGAGACTGCTGGTTCACGCTGTCAGCGCTATCGCTGCCTTAAGCCAAGACGTGCTCGTGTGCATCCCCCGAATCGTGGCGCTTGGTATAGTTGAATTGC
TGTCCCCGTTCCTCGCACGGCTTCGCCTTGATGGAAATCCAAACCCCCATCTGGAATCGCTACAATACTCCGCGGTGACTATTATCCGCTCCATTGCGTC
ATATCCATTTGGTGAGTACCACGCGTACTTGTCAAATGCCAAAGGTTATGTTCCAGATCGAGCGTCTGTCGATGAGAAAACAAAATCAGGCAAGAACGAT
AAAAGCGCGGTGGTAACGCTAACGCTCGTCATGGAGCGAGTGAAGCAGATTGGCTACGACTTTGCAATGGAGCTTCAAAACAAACCCATCGCTTTGCGGG
ATAAGAAATCTGTCGGTGAGCTAGCTCGGGAGACGATGGCTTTCATCAACGAGCATCAACAGCGACAACAGCGGCAGTTGGAACAACGGCGGAAATCGAG
CGCTAGTAGCGCTGCTGGGCTCAAAGGAGGACTCTCCAGCCGATCAAGTGGGAAGACTAGCCCAGTTAACAGGAAAAAAACGCAAGCGTGTGCATCTTTC
CCAGCACTACCACAGTCTCCTGTCGGGCGGTTGGATGAGTTCACGGACGATCGGTCAACTTCGGGATTTCGAAAAACAAAAAATGGTAGCAGTGCGATCA
CTTTAGAACTCAAGCCGAATGTTACCCCGTCGATCCTTGTTCTTGACGGTGGATCGACATCGCCCGTAAGTTTGAACGGAATTAACATTGCTTCGACGAG
ACCTGCTGGTAACAACAAGCCACGACCTTCATCTGAATCACCCCACACTCATCATCACTACGTCTTCACAAGACCAAAGTCTAAGCCCAAACGGCGAAAT
CAAGACGCCGCGTACAACCTAATGCTCGATCCATTGTTTGACTCGAGTAGTGGTCCCACGAATCCCCGAAAACTAAAGACAAACGAGCAGCATCCTAACG
AAGAGGATTGCGACTATGGTTTCTCTCAGGAAGTTGATCGCTTCGGGCATTACGTAAATATTCAAGCGCGCCGTGATAAGAAAGGGGACCGGTATTTCCC
GTCTTTAGGTCGAATTGTCACCTCCGACGCAAACTTGTCGAGTTTCTCGATTTTATCGTCCGACGCGTATAAACATTCGGTTGGGTTTTCTCCATCGCAA
ACCAAGACGAATTTTTAATCCTCTATTTAAGCGAAATGCGAGGCTAGCAACAGCTGCACTATTTATCAGCTCAGCGGGA