Transcript Name :
Phyci_23
Orientation:
(-)
Number of Exons:
2
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-207
NN-scoreoddsWeighted Score
0.694.1550.008
*** None ***
TypeScore
cytoplasmic478
GO
*** None ***
*** None ***
*** None ***
Sequence
        697 bases(100 bases per row)
ATGCCGCCAGTGTCCTTCCAGTCGATCGCGCACATTGGCACGGCTACTTCAATCCTGTCCATGGACGCCGTCAACTTCTTGATCGACCCAACATTTGACA
ACAGCGGCGACTTCAATCAAGAGTTGGGCAACTTCAATCAAGCGAGCGGATTTGTGTTCGTGAAGACCGATGACCCCACGCTCGGAATCGAGGATTTGCC
TGTCGTCGACGCTATCCTTCTCAGCcaccaagaccacggtgacaacctggatggatcaggccgcacaatgctgaatgggcgacacgtcttcaccaccctg
aacggtgtcaagaacctcgcctccccctgccctggtgttcgtggatgtgccgtgtgagtccacgatgataacgctgaacggcacgccgttcagaatcact
tgaactcccacacagcatctgcctagaggggggtgcacggggttcgtgctcgagtcgccctcgtttggtgcgaacgaggcagacggcctgccgaatgttg
tgtatgtatcgggtgacacggtgcatattccggagctcgcgaaagagcttccgaagagataccacgctgatgtggcgctcatgaacctcggcaaggccgt
tgctccgctgccgacggggcctgtccagatcagaatggacggcatgcaagcagctcagctaatccgcggcattggcgcggagaagatacacttctag