Transcript Name :
Phyci_262115
Orientation:
(+)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
SET domain10.856PS50280
Post-SET domain10.347PS50868
HmmSmart predictionP-Valprediction_id
SET domain0.0043SM00317
Post-SET domain3.4SM00508
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Post-SET domainIPR003616
*** None ***
InsideOutsideTMhelix
1-210
NN-scoreoddsWeighted Score
0.8084.3320.009
*** None ***
TypeScore
mitochondrial783
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1082 bases(100 bases per row)
GAACGAGCATGTGGTCGCGCCTTCGTCACGGCTGCATTGCAGTGCAATCCCGAGGTCATTTCCCAATCTCCTCCTCACAGTCGAATCCGGCTCGAGAGCG
TCAGAAGTCTCCACTCCCTCCTTCCCCCCTGCACCATGCTGACCCGCAACATTCCGCTGGCCTCGCGCTCCGTGACGTGCATCAGTCGTCGCCACTTTGC
TGCTGCTACCGCTTCAACCAGCGCCAAGCGCTCCAAGGTCAACGGCCACGGCCACGAGGCCCAGCAAAGCGGCCAGCTCAGCTACGTGCCGTCGGGCTCT
GACGGACGCTTCATCATCGAGCAGCTGTACGTTTAACAGGACATCAGTCAATGTTTCATGGAGGCAATCGTATCTAATTAGCTTGGATAATTGCGCCTGA
TAGGAACGAGCACTGGCGATCGGCAGTGGCTGGACAAAACTTCAAGAAGGACGATGTCATTGGGTCGGCCCCCGGCAATTTGGTGAGTTGCTCGTACTTC
GTATCGGCTGCAAGATGCGCACGATAACTCACTCGTATCTTTCCGGTTTTCTGCCTTTCAGTACTCGAAGCCAACTCGGTTCACGGTGCAGATCACACCC
GAGAAGCACATGGACTTCACCGGCGGGCTGGAGTTCGTAAACCACAGCTGCAACCCCAACACGCGCATCGACATGGCCGAAAATGAAGCCAAGGTGTCAT
TTGTGGCAATCAAGCCAATCTCCAAGGGCGAACACTTGACGTTCGACTACTCGACGAGTGAGTGGGACATGGACGAGAAATTCGACTGCCGTTGCGGTGC
ACCCAACTGCCGTGGCCACATCGGCGGTGCCAAGTACCTTAACGATGAGGAGGTAAACGCGAGGCTGCCGTACTTCACACCCAGTGTGCTGCGTCAGCTA
CTCGACCGCAGGCTGTCCAACTAACTTCGGGAAGAGTGTCTAACTTACTCGAACCGCCGTAGCGTTCCTCGTTGATGTTACCAAGGATTTTGTCCACGAT
GATTGTGGATTGAAGCCTTTAAAGAATGTGGTCGGAAGCAACCATAAGAGCAGAATGAAATGGACTGAAAATTTACAACCCC