Transcript Name :
Phyci_75503
Orientation:
(+)
Number of Exons:
3
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site6.833PS50096
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-959
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3053 bases(100 bases per row)
ATGGCAGACGTCGTGGATCCGCCGACGCCTCCGTCCTCGCAGATGCTGTTAGCGGTGCACCACGCCCGATACACGCAGCTCCTGCGCGCCTTTCTAGCGT
GGAAACGGCGCGCTCAGGCGCAGTGTGCGAGGAGAAAAGTGAGGCAAAGTCTACAAAATATACTCCGACTCTCTATACCTCGCACATAACTAATGTGGGA
TCTCCGGTGTGAATATAAATATAGCGAGTCGCTGCAGCTTGTCGCGTGGGCTCCGTCTTCTACGAGCGGATCTTCTGGACGCGGTGGAGAGAGTTTGTTG
CTGAAAGGCGGCAAGAAAGACAGGGAGCTCGAGAAAATGAAATGAAGAAACTGGAAGAAGGAGAGGAGCTGCCGGGCCCAGATGAGAAGAGTACGAATAA
TGCCGACGTTGCGGAGAAAGCAGATGCAATAGTGTCTGCGTCAGATGGAGAAGAAAATCGTGAGGAGGGTGCTGCAGTTTTGAAGACTAAGAAGCATTAC
TTGAAGGTGCAGAAGCTCTCGCCGCTTTCTCCTGCGAGGGGCTGATGGTTCCGCTGATAACCGCAACTAACCGTGGTTATCATCGCTGTGCAGAGGTGGG
AACTGAGGGTTGAGCATGATAAGAAGAATGCTGAAATTGGCAATAGTGTCATCGTACGCATCCGTTCAATGCACGCTATTCGGCGTTGGAGAAGGTTTGT
TCGGACGAAAAAGGATGCCGATGTGCTCCAGCAGCGAGCCTACTTCTTTTTGTACTACTGGCTACTCAAGCGTTCGCTGAACCAGCTCGGTCGACACGCG
CAGGTTAAAAGGCGAGATCGGCAACTGACAGTTACGATTGTGAAGGCCAGCAGACAACGCTTGTTGGTCAAGAGCATGCAGCGCTGGCGATTGCGTCTGC
GATTACATCAAACATTAGTTTTGTGGAGTGGCTACGTTCGGCGGAGACGGCATCAAACATTACTGTACCGACCGATTGCCGAGGCTCTGACGCGGAAGAC
TCGTCGGTGCATACTCCAGCACACTTTTGATATCTGGGAGAAACAGCATGCGAGGATACGAGCGCAACGTATGCTACTCCGTGTCATTGATCGCCACTTG
TATCAGAAAGTGTGTAAAAGAGCGTGGACGACATGGAAAATTAAAGTACGCCAGCTAGCTCGGCTCGATACTTTTCATCGACGTTCCCAAGAGTTTCGGT
TGCGACGCATTTGGGGTGCCTGGAGTGCTCGCGCTCGAGAAAAAGAATACCGGGAACAGCAAAGACGCCGCGCAGTGCGCCACTACTACCTGTCCCTATT
GCGTAAGGGTCTAAATGGTTTCCGGGCGTGGCGCATGCAAGGGCAGCTCAGATTAAGCCGAGTGGAGACTATGCTGAACGCTGCAGACGCCAGAATCATA
ACATTTGCTTTCGCACGCTGGGACCATTTTACAAGTATCAAGAAGGGACAAGCATTAAAGTACAACCGTGCTTTACTTCATTCCCAATCACAACAGTTGA
AACGAATTTGGACGAAGGGGTTTCTGTGCTTCTTCACTAAAGCTCGGTCCAAGAAACGAATGTTGCTTGCTGCGAATGAGATGTACTATACCCGCTCAGT
GGGACGTTGCTTTCGTACTTGGAAAGATATGTGGCAAGCCGAGCGAAATCGTGAAGATATGTTGAGTAAAATGTTGCATGGTTATATGGTGACGAAAGGG
AGAATTATTGAAGCTGAAGTGTTGGAATACTGGTCGGAGTTCACTCGTGCAAAGGCTGCAGCGCGAGTTGTTAATGCTCAAGTCCGGGGATATGCGCAAC
GCCGCACGCTTCAAAAATATTTTTCGCAATGGATTACATATGTTTCCATACTACGCTGGCAACAAATTACGCTTGCACGGGCCAAGCAACATCACAAAGC
TGTACTCTTTAGGAAATGTTTTGACCGGTGGAGACACAACGTATTGGTGCGTCAACGTTACCGCAAGAAGACACGAATTGCGCTCATACACTGGAAATTG
ACGTTAGAGCGTAAAGTATTCAATGGGTGGGAGCAGTATCTGGAGAATAAGCGAAATAAACATCATCGCATTCACGAAGCCCTCGAGTTTCGGCATGAAC
AGTTTGTTCGAGATGGCTTGCGCAATTGGATGACGGCCGCGATGCATTTGCAAGAGCAACGTGAGCAGCGAGTGACTATCCTTCAAGCATGTAACACGAC
GAATGTGTGGCGCCGAGTTGCAGCAATAGCTCGCCATTGGCGCTACCTTGCAATTCGGCGTAGAGCTCTCAGAGATCAAGGGGAATTTACCGAGATTCCT
AGGGATGCGCCACGGCGATTTCAAGACATGTATCGGGCATCCGAACACCCGCCAACAGTACATGCACAGGCCATAAAGACCGCGGTACTAGCACGAGGAA
TCAAGAGCAACCTCAGGCATGCAGGTGTTTTTCCAAACGATTCAGAGAGTTCCAACTGGACGAATGAACCATCTCCACTTTCCGAGTTCGTGCTGCTTCC
AAGAAACCGGCCTCAGCCTCGAAGACCTGTTGATATTATGCTCTTTGCAGAATTGAAAACGAAGAGCTTGGGTCGAGGCAAGGATAACACGATTACGCAC
GAAGCCTTACGATGCGGCTTTGATTTTCCTGATGAGCGTTTTGCTCCTCTCAGCCCGCCACCGCAAAATCAAGTTCCCCAAGCGAAAAAGAAGTTACCTT
CTGCAGCAACCTCAACCGGAGGGCATAGTAAATTCTGTGGATTATCGCCTACTTCAGGAGTGCCGCCTCGAGAAGGAGGCGATCTGATCCTGCCCAGCTC
TACATTGAGCCAATTGGATGCCTTGGAGCGACAGCTACTAGCACTAAGCAAGCGAAAACGGGATTGGACGGCTTTCCAGCAACAACTCAACACATTACGT
GGAGAAGTAAACAGACACCCGCGACTTCTATCGAAGCTAAAGGCAATGGAGGAGCAGCACACGGTGCGCACAAAGCAATGGCTTCATACAAAAGAACGCA
TTCGTTCTGTAGCGACGGAGATCCGACACTTGAGAAATGCTTTACAGAGATAA