Transcript Name :
Phyci_205925
Orientation:
(-)
Number of Exons:
1
Description :
ubiquitin-conjugating enzyme e2-16 kda
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin-conjugating enzyme, E244.309PS50127
HmmSmart predictionP-Valprediction_id
Ubiquitin-conjugating enzyme, E23SM00212
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-147
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K06689
K06689
*** None ***
Sequence
        444 bases(100 bases per row)
ATGGCTCTGAAGCGGATCAACAAGGAGTTGCAGGACCTGGGCCGCGACCCGCCCGCCAACTGCAGCGCCGGCCCCGTGGGCGACGACCTGTTCCACTGGC
AGGCGACCATCATGGGCCCCGAGGACAGCCCGTACGCCGGCGGCGTGTACTTCCTGAACATCTACTTCCCGGCCGACTACCCGTTCAAGCCGCCCAAGGT
GAACTTCACGACGCGCATCTACCACTGCAACATCAACGCCAACGGCGGCATCTGCCTGGACATCCTGAAGGACCAGTGGAGCCCCGCGCTGACCATCTCG
AAGGTGCTGCTGTCGATCTGCTCGCTGCTCACGGACGCCAACCCGGACGACCCGCTGGTGCCTGAGATCGCGCAAATTTATAGAACAGACCGCGCGCGCC
ACGACGCCACTGCCCGCGAATGGACCGCCAAGTACGCCACTTAG