Transcript Name :
Phyci_88710
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Tubulin1.2PR01161
Tubulin1.2PR01161
Tubulin1.2PR01161
Tubulin1.2PR01161
Tubulin1.2PR01161
Tubulin1.2PR01161
Tubulin1.2PR01161
*** None ***
HmmSmart predictionP-Valprediction_id
Tubulin/FtsZ, GTPase domain3.9SM00864
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Tubulin/FtsZ, GTPase domainIPR003008
*** None ***
InsideOutsideTMhelix
1-514
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
microtubuleGO:0005874IEA
microtubule-based processGO:0007017IEA
*** None ***
*** None ***
Sequence
        1570 bases(100 bases per row)
GGAGCTCTTCGCTGGGGGGGTCCATGAGTGTGCATGTGCACGTGGGGCAGTGTGGCAACCAGGTGGGCGCCGCGTACTGGCGCTTGGCTGCTGCTTCGGG
TGATGCGCAGCCCGACAATCGCACTCGAGGTGGCGCTCGACAGTTTGGCAATGGATCTGCCGCCGTGAACGTCCCCAAGAAGCCTCTACCGGTAGCGTTG
TCCAGACACTTGTATCATCCGTCCAGCCAAGCTGCGCGTTGCATTCTGGTGGACTCGGAGCCGAAAGTTGTTCGCGCTGTGTGTGAAGGAGGAGCTGACG
TGGTTGCAGGCTTCCAGCCGGCTCACACGCATGTGGAGCAAGCTGGGCGAGGCAATAATTGGGCTATGGGGTACTACGGACCGAGATCGAAAGCTCCGGC
GCCGGCCTTCACGTCGCTGGCCGTGGATGAGCGCAGAGAGCTGGTGGAGCTGGTGATGGAATCCCTACGACGCGAGATCGAAGCGGTGGATTGCTATCAG
GGCAGTGTGGTGATGCACTCGCTGGGTGGAGGCACCGGGTCGGGGTTGGGATGCCGAGTGCTCGAAAGCATACGAGGCACGTACCCGAAGGCGTACATCG
TGACTGCGTCGGTGGCTCCGTCTTGGTCACGTGGGGATTCGCCTCTGCAGAATTACAATGCCGTTCTGACTCTGCGATGTCTGCAAGAAGTTGCTGATGC
TGTCATTTACAAGGATAACGATGAGCTGCTGCGAACGGCAGCGTATTGGAAGGCTGTGGGCCAGGAGAAGCTGGGGGCTGACTGTACGAATCAACGGGTG
TCACTTGTTGAGATGAACAGCATGGCGGCGGCAGATCTTGCGGGGTTGTTGTTCCCAGTAGGGCCGGGCGATTCTAGTACGTATCGGTCGTTTGATTTCG
GCAAGTTACTACATGATGTATGCCCCATGCCTTCAGCGAAGATGCTTGACGTCCGTGCTGGAGTGTGGAGAGATCGTGTTGGGTCGGGTGTACGGAGTAA
ACTACCGTCTAAGGCATCAGTTGCAAAAGATGTCTCCGCAGCCACATTGTTTCATGCACCAGTGGTTCCGCAAGCGCGCTCATTGGCGCTCCGACACGAG
CATGCTGCTGACTTCAACACATCCCTTGATATGCTCGAAAAGCTAGTGCATCAAACAATAGCTTCTTTTCCGCGGAATTCTTGCACAACTTTGGCATCGA
GTACACTAATTCGGGGTTTCAATCCAGTCTCAAGCGAACTTGATCGTTCCTCGGAAAAGCTTGGAGCAATGGTTGAGACTGCGTTCCCTCCTGTGCCTTG
GTTAGCGGCAACTCCACAAGCCGCGCTCAGTTTTTCTAAAGCTGCACCCTATCCATCGCTCCAAGCGAAAGCTTCAGCAACAATTTGCGCGAATAATGGT
AGCTTCTTGACAAGTACGAAGCGTTTCTTAGAACGAGCTCAGCGCCAGTTCCACGCCGGTGCATACGTGCATTGGTACAGACAGCACGGAATGGAGGATG
CCGAATTTGATGTCGCCTTTGACAAATGCGCGACGCTCATAAGCGAATACGAAACCTTATTGCGATGATT