Transcript Name :
Phyci_206547
Orientation:
(-)
Number of Exons:
6
Description :
3'5'-cyclic nucleotide phosphodiesterase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
3'5'-cyclic nucleotide phosphodiesterase2.53462PR00387
3'5'-cyclic nucleotide phosphodiesterase2.53462PR00387
3'5'-cyclic nucleotide phosphodiesterase2.53462PR00387
3'5'-cyclic nucleotide phosphodiesterase2.53462PR00387
3'5'-cyclic nucleotide phosphodiesterase2.53462PR00387
3'5'-cyclic nucleotide phosphodiesterase2.53462PR00387
*** None ***
HmmSmart predictionP-Valprediction_id
GAF domain0.01SM00065
GAF domain2.7SM00065
GAF domain2.3SM00065
HD/PDEase domain8.5SM00471
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1156
*** None ***
*** None ***
TypeScore
nuclear478
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
protein bindingGO:0005515IEA
KO ID
K13761
*** None ***
Sequence
        3811 bases(100 bases per row)
ATGGCGGACGACGAGGTGAAGCTGGTGCGCGTGCCTGTGCGGGAGCTCACGACGGCTATGGAAGGTGCCAGGGCGGCGTTGGATGAGAACCGTCGACTGG
CGGAGGAACTCGCGCAGATCGAGGAGGAAGCTAAGGAGCTAGAGATTAAGCTGCTCAAGAGGCAGCAGCAGCTAGACTGCTGCACGGAGTCCCGTGCAGA
GCACCGTCCGTACCGACCGGGCGACTTGTTCCACCCCGCGACACCAAAGCGGCTGAGACCGAGGAGTGAAATGTTTGGCGCTAGTATTCGCAACCTCATC
GGAGAGCAGGCGGAAACACTGAACCAGCTCGCTGAGCGAGAGGAAAATGTAAGCTAGATCGGAACCTCCCGCATCTTGTAATTGAGTGGAGGCGCAAGAT
TTGTGTCGCTCACGATTATGCATGCTTGTAATGCAGCTCCGTGCGCTGATGGACGCCATGCGTGAGGTCTCGCAGGCGCCGGACAGCCTAGACATCGTGA
GCAATGCGCTTCGAGCCGCGCAGCACGTGCTCCCCGCCGAGAAGTACACCGTCGGTATTCTCAGCGAGAAGAAAGATCGCGTAGACCTGTATTCGAACCC
GCCAATGGATTTGCACGGCAAACGCTACCTCACTGAAGAAGGCAGCGTTCTTGTTGATTCGGCCACCACGTTTGGCCGCGTTGTGCTGGTACAGTTTTCC
TTCTAAAACGTTTGAAAAGCTTGGTTGATTAATTTCTGTTGCTGCGTCACTTGTCCTAAGACTGGAACGCCTCTCGAGGTGGCGGATGTCAGTGGTTCTG
AAGTTGTCGACGTGTTCGAAGAGCAAATGGAACTCTTAGAGTTTGAGCCCGAGGCCTTGCTCTGCGCACCCATTTTCAACGTCCACGGCATCTTAGTTGG
TGTCTTCCAAGTCATCACTCGCAAACAACTCCCAGAGCTCGGTCTCCTGCCAACTCCAGCTCCGCCACCTGAGCCTCTTTGGTTTTCTTCTACTCCTCGG
TCCAGCCTGGCAAAACTTGGGCAGAACGAGGAAACTCAAGAAAAAGAAGCGTTTGACCCACGCGACAAAGAGAGTTTTGATTACATCTGCGTCACTGCAG
GCACGGCGCTGTGGAACCTGTCACTTGCCAAGGCGCACCAGGCCATGCAGAGTCGTATTGAGTGTCTTCTGAAGCTCAACCGAAATATTGCTGCTGAGCT
CAGCGCGTCTGCTGTGCTTCACCAAATTATCGCAGTTTCTTACGAGTTGCTCCACGCAGAGCACATCGCACTCTATGTGCGAGATGAAGGCACGGAAGAA
TTTTTCCTCTTCGTCACCGAGTGCAAGGACACATCCTCATCCAAAGGTAAAACGAAAGCGAAAGAGAAACCAAACGATAGACCTCATCAATCACACTTAC
GGCACGGCGGGTATGACGAGGCGTTCTTGAAAGCACACAACGGTATCGTGGGGGTCGTTATGCGGACTGGACAGCTTATTCTCACGAACTCAGCTCCAAG
CCATCTTGCGTTTGATCCGAAGTTCGACGAGCTATGGACATCGCTCAAGACGAAGCAAGTGCTTTGTGCGCCTGTCAAAGATGCAAGTGGACATGTTTTG
GCCGTGGTTTGTGCCACCAACAAGGTTGACGGTGACGAGTTTACATCAGATGACGCACTCTACCTGAACTACGCCGCAGAGGCCGCAGGAATCTCGCTGC
ACAAGTCCAATTTACTACGCTCTGTGCTGATGTCGCAACGCTTGACAGAAGCACGGCTGCAACTCGCTGACTTTGTGAATAACAATGGTGAACGCCCGTA
CAACCACTCTGGTTCCGGAGCCGAAGACGAATCTAGTGCCGCTGCTTCTGTTGCTAGATTCGTCCGAGTGGTCATGGCAGAAGGCAGGAAACTGATGCAC
TGCGACCGGTTCGGCTTTTTGCTTGTGGATCCGCTGAAGAAAGAACTTTGGATCACCCAAGAAGATGGAGAAAGTGTGAGGATGCCGCTCACGAATGGAC
TCTCCGGGCTGATCGCTACAACAGGGAAGCCGATATGCACGCGTGACGCTTACACGCACCCGCACTTTGATCCAACGCTGGACCGAAAGACAGGGTACCG
TACCACAACCGTGCTGGGAATGCCTGTGTTCGAGGATCACACGCCGACCAATCCCAAAATCGTGGCTGTAGTGATGGCCATCAATAAGAAAGACGACAAC
GATGACGACGAAGCCAACAACGCGAAAAACGATGATGGTGACCCGCCTCCTGTGACGAGACAGCGCGTCCCTTTCACTATCAGCGACGTTGATTGCATGG
CCCAGTACTGTCGGGAAATTCAATTCGCGCTTGGCCGATTGTCGCTGGACATTTCGTACTACAAAGTGGTGTCGGACTGCGGGCTTGGAACTCCAGGTGA
GTCCTTGGCCGATTCATCTGACCCATCCAAAGCGCAGGACCAGGCAGCAGCAGATGATGTGAACGAACCGGAAATCATCTCCTCGATTGTGCAGAAGTTC
TGCCAATCTAGCGAGCTGGACGTGCTTGAAGAGGTAGCAGGTGCAGCCATTGCTGACGATCCTGACGATGTGGAAGATGCCAATGAAGCATACGGTGGAG
ACTACGACGAAGATGACCAAGATACAGAGGGTGAGGAAGAGCGTCCAACACCATTTGCCGCTGTTCCATTCCCGCAGCGGATTCCTCAACGACGAATTTC
AACTACCCGTGAGAACGGGCACGTGATCGGTGTCGGCGACGTGACTCGCTGGGATTTCTCCTGCCTGGATCTCTCCAACCCCGACATATTCGCGGCGACA
TCTGTGCTCTTTCGGTCGCTTGGGCTGTTGGAACGCTTCCAGGTTGGTCAGGAAACGTTCTCCACGTTCCTCTCACACGTTGCCTCCCATTATCGCCCCA
ACGCATTTCATAATCTTCAGCACGCGTTCCAGGTCACGCACGCAACGTATTGTCTGCTGCGTCGCTCGGGAGTAGCGAACTCGTATTTCGCCCGGGTTGA
AGTTTTCGCAATGCTGATAGCTGCATTGTGTCACGACTTGGACCACCCAGGCAACACCAACGATTTTGAGGTGAAGGCGCACAGTCAGCTCGCGCTCACG
CACAACGATGATGCTGTACTCGAGCGTCACCATTGTCGCGTGGCATTCATTATCTTGAGTCATCCAGGAGCCAATCTTCTGGCACGGTTGCCCTCTCGTG
CCTGCTTCGTATATGTGCGCCGACTGTTAATTCATTGCATTCTCGCAACCGACATGGCAAAGCACTTCGAAAAGTGCAAAGCTTTGGAGGGACTTTCCAA
GCGCCACCTTCTTGTTAACAGCAACGGGGGTAGAGGATCGAGGCGAAGCCGAAGCAAACATCGCTTCGTTTTCATGGCAATTATCATCCACGCCGCCGAT
TTGTCAGGTCAAGCGCTACCGTACACGCAGGCAGTCCGGTGGGGCATGCGCGTGCTCTCCGAATTCCAGCAGCAAGCAAAGAACGAGGTCGAGATGCACG
TCCCGGTCGAGTCGTTTATGACAAATCTGCACCACGCTAAGACACGGGTCACCGTACAACTCAACTTCATCAACTACGTCCTGCGCCCGATCTGGCTGCC
ACTGGCCGCCCTGTGTCCTGCAGTTCGGGTTTACGCAGACTCATTGGAAAGTAACCGAGAGCGCTACAAAGCTGAGCTGGACAAACTCCAACGTGAGGCA
GAAGAGATTGCAGAGCTGGCAAGAGAATACGTGCGCGGCAACAGCTCACGCAGTCTTGTTGAGCATGCGTCCAGCACAAGACGATTTTCTAGTTTGTCCC
AAAAAGGTTAG