Transcript Name :
Phyci_75498
Orientation:
(+)
Number of Exons:
4
Description :
Rab32 family GTPase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Small GTPase superfamily5.5PR00449
Small GTPase superfamily5.5PR00449
Small GTPase superfamily5.5PR00449
Small GTPase superfamily5.5PR00449
Small GTPase superfamily5.5PR00449
Profile scan predictionP-Valprediction_id
Ran GTPase28.978PS51419
HmmSmart predictionP-Valprediction_id
Small GTPase superfamily, Ras type8.3SM00173
Small GTPase superfamily, Rab type3SM00175
Small GTPase superfamily, Rho type1.3SM00174
Ran GTPase2.2SM00176
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-218
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
intracellularGO:0005622IEA
membraneGO:0016020IEA
intracellular protein transportGO:0006886IEA
protein transportGO:0015031IEA
signal transductionGO:0007165IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        887 bases(100 bases per row)
ATGAGCGAGCGCCGAGTGAACGCCGCGCAGGACGCGGTCATCAAGGTGCTGGTGCTGGGCGACGCCGCCACGGGCAAGACGAGCATCATCAAGCGGTGCG
TCTCTGTGGGCGAGCGAGAGAGCAGGAGAGGGAGGCGGACTGACCTTTTTTCCTGCTGGCAGATACGTGCACGACGCCTTCTCGGAGCACCACCGCACCA
CCATCGGCGTGGACTTCGCGCTGAAGGCAGTGACGGTGAACGGCACCACAGTGCGCCTGCAGCTCTGGGACATCGCCGGCCAGGAGCACTTCCGGGCGCT
CAACCGGGTCTACTACAAGGACGCGCTGGGCGCGCTGCTGGTGTACGACATGTCTCGTCCGGAGACGTTCGACAGCATTCTAAAGGTGGGGGGCAGAGTG
AGAGAGAAGAGAGAGAGTGTACATATGTAAGGTGGTTCGCTGACGTGGTGTTGGGTACGTTTTGATCAGTGGAAGAAGGAGATCGACTCAAAGGTGGAAC
TCCCGAACGGCAAGCCGCTGCCCGTCATTTTGTGCGGCAACAAGGTGCGTTCGTGCTGCTTTCTGCTTGGGGTTGACGGTGGCCGGAAGTGCTGAGTTGT
TACTGGGTGTTGTGATGCTGCAGTGCGACCTGAAGGAGGACGTGGACCGGGACTTCCTGGACGAGTTTTGCAAGACCAACAACTTCACGGGCTGGTTCGA
CACATCTGCGAAGGAAAACATCCATATCGACGATGCTGCGAAGGCGCTGGTAACAGGCATCCTGGAGCACCAGGACATTTTCGAGCGAAAGTCGGAGGCG
AAGAAGCGTAATGACACCTTCCGCCCCACGAATGCTGCCAACGGAGGCAACACAAACCAGTCCAGCTGGTGCTGCAACAGCTTCTAA