Transcript Name :
Phyci_262018
Orientation:
(-)
Number of Exons:
2
Description :
P-type ATPase (P-ATPase) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase6PR00119
Cation-transporting P-type ATPase6PR00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1168-1218
1284-1289
1350-1572
1-1144
1242-1260
1313-1331
1145-1167
1219-1241
1261-1283
1290-1312
1332-1349
*** None ***
*** None ***
TypeScore
endoplasmic reticulum667
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        4908 bases(100 bases per row)
ATGCGGATCCAGGCCGAGGCTGCGGGACCTCGCGCCGGCTCCGACCCGGCGCAGCGTCTGCGCGTGATTCGCGTCGACCGCAAGTTGCTCCAAGCGCGGG
CCAACGCGGCTCAGCGCCGCCGCCGCCGCGAGGAGCGCGAGGCGCGTCGCCTGGGCAACCGCCGGCGGTCGTCGTGGCTCTTTGGGGGCGCCAAGAGGCC
GCACGAGGACGCGGTGGAGCCGCCGTCGCCCTTCGCGAGCAACGTGGTGGTGAGCGCCAAGTACAGCGCCTGGAACTTCGCGCCGCGCGTGCTGCTGGCG
CAGCTGCAGCGGCCCTCGAACGTGTACTTCCTGTTCATCGCCGTGCTGCAGACCATCCGCGAGGTGAGCAACACGAGCGGCATCCCGACGATCCTGCTGC
CCCTCGCGGTGGTGTTCGTGTGCAGCGCCATCAAGGAGGCGCTCGAGGACCGAGAGCGACACCGCGCGGACCGCGTGGCCAACAGTCGACCGGTGCTGAC
GCTCACGCCGCTGGGCAGCTGGGAAGAGCGCCAATGGGGGGACCTGCGCGTGGGGGACATCGTCAAGGTCATGAACGACCAGACCGTCCCGGCCGACCTG
TTCCTGCTCTCGGCGGAAGCGGTGGAGCATGATGACGACAAGAGACCCACTCAGGTGCACGTGGTGACGGCCAACCCGAGAGAAGTGCAGGGCCCAGACG
ACCTGGAGGAAGGGAAGAGAGACGACGCGAGGCTTCTCATAGATGTTCAAGACGACCAGGGATCGTACGAGCCACCGACGCCACCGAAGCAGGAAACAGC
CGAGGCCAACCTGGCGTACATCGAGACCAAGTCGCTGGACGGCGAAACGAACCTGAAAATCCGCACGGCCATCCCGTTGGTGGCGTCGCTTTGTCGAGGC
TCTGGAGACTCCAACCGTAGCATTGATGGTGGGGGCCACAACGAGTTGCGCGGTGTGATGGTGTGTGAGCAGCCGAACGACCGTATTACGAGTTTTGAGG
GCACCTTTTCGGCTGCGCTCAGCCCTGCTCAAGCACAGTCGTTGGGTGTTCCTGTCAGCGACCCGAGCTCTGCTTCAGTTCGACCTGCTGCAAGTCTCTT
GCAGACAGAGATAGACGCGGATGGCCTTGTGCGTGTGCGCATGCCAGTCACGGCAAAGCAAATGATGCTGCGGAGCTGTGTTCTTCGCAACACGCGCTCA
GTTACGGGCATGGTGGTGTTCACAGGGCACGAGACGAAGGTTTTCTGCAGCAACACGGAGCCTGTTGTCAAGACTTCGTCTGTAGAGCGACGACTTAACC
GACTCATTATCGGCATTGTATTTATCCAGCAGCTCGTGTGTTTCCTGGGCGCACTACTGGGGGCGCATTGGATGCACACGGAAGGCGACTCCTTCTGGTA
TCTTATCAGTGCTAGTGAGCGGCGGCACCACGTGTTGACTGGAGCGCCCACCTCACACCCTCTAGCTGAACTCGCCAAGCTGCACTTGCGATACTTCATC
ATCATGCAGAATTTTGTTCCTATTTCGCTGAACGTTTCGTTGGAGTTCGTCAAGTATTGGCAAGCATACTTCATCGAGCAGGATCTGGAGATGTACGACA
AGCAGTCAGATACCCCAGCCATGGTGCGATCGTCAGCGCTTAACGAAGACCTAGGGCGTGTGCATCATGTCTTCACGGACAAGACCGGAACACTCACGAT
GAACCTCATGCTCTTTCGTTACTGTATGGTCGGAGGAAAACATTACGGTGGTATCATGCAAGACCAAGACATGGAGGAGGAGGTACCCAGCCAAGCTTCA
TCTCCCTCGTCGATGGTTATGAAGGACGGTCTAAGGTTTGTGGATTTCGACCCAACCGAGCTTTTCGCTGATCTTCAAGCAGGAGGCGAGCAGGCAGAAA
CTCTGCGTCGCTTCTTACGACACTTGGCACTTTGCCACACTCTGATTCCCACCAAGTCTCTTGTAGAAATGTGCAGTACGTCGTTCCCAGAGTACTCAGC
ATCGTCGCCCGACGAGCAGGCATTGGTGTCCGCAGCGGCATTCTGTAATGTTCGGTTTGTGCACAGGACACCCGCTACTATGATGCTCATGGAACCCGGG
TTGACGGTTCCTAGCACACACAAATTGCTGAATGTGCTCGAGTTTGACAGCGACCGAAAGCGAATGACAGTGATTGTAGAAACCCCCGATGGTACAATCG
AGCTTCTCTGCAAGGGTGCTGACAATGTCATTTTTGAACGTCTCGCTACCGACCAAGCAACTATGCCTGGCGGTATGTCCTACGATCAAGCTGCTGATCA
GCTCACGGTGTACGCAAAAGCTGGTATGCGCACACTCTGCCTCGCGTATAAAACGATTAGCAGAGCAGAGTACGAGAACTGGAACACCCGTTATTCACAA
GCTCATGCTTCCATGGAGGAGCTAGTAAAACGGCGTCAAGGCCGCGAAAATGCGATCGACCCACTGATGAACGCGATTGAGCGCGACCTGATCCTTCTTG
GTGTCACTGCAGTCCAAGACAAGTTACAAGCTGGAGTGCCTGCGACACTACGTCTACTGCAGGACACAAACATTAAAGTTTGGACGCTCACAGGAGACAA
AATGGAGACTGCTGTGAATATTGGATACGCTAGTGCTCTGCTTTCGCACGATATGGACGTCCAGCAGATTGGCGGTGATAACTACTCTTCAACAGCAGCA
GCACTCAAGGAGTTGTCCCAGCGTGGTGATCAATTCACTACCTCTTCTCATTTATCTCCGTTTCTGGCCTCACTTAATACTACATCCTCAAGGGCCAACG
GAGGAAGAGGGGCACGACGTCACCCTCGTGATGGTAGGCGCCGGTCACAAGCCAAAACGAGCACTTTCCTGGGCAGTGCAAAGGCGACCATCAGCGAGTT
TTTCTTCGGAACCCCGGCGAAGCACAAGCGCAAGCAAAAGCGAAAGCGTCACCGAAGTCGTCGCACGTCCAGGACATCGTCTGCTTTTACCCAGACACCA
ATGTATTCGTCCGTTGCGACTGACGCCGAATACGCAGATAAATTCACGTCCGATGAGGAATCGTTGTATGATATCGGAATTGACGCCGATGATGAGGCAA
TCCACACTCCAGAGTACGGGTCTCTCGCAGGAAGTTTGTACGGTAGTGAAAACGATCCACAGAATGGCTCAAGATCGCAGCAGTTGGCGCTTGTAATCGA
TGGACAAGCCCTCGAATTTGCTCTTCGCCCTCAACTGCGCAAATTATTCTACCAAGTCACTCGGCAGTGCGCTTCAGCGGTAATTTGCTGCCGCGTGTCT
CCCAAGCAGAAAGCTGAGATTGTCGAGTTTGTGCGTGAATTTGAGCCGGACAGCGTGACGCTTGCGATCGGAGATGGAGCGAATGATGTAGCGATGATCC
AATCCGCGCATATCGGTGTGGGTATATCCGGCCAGGAAGGAGCACAGGCTGTGAACGCTTCGGATTATGCATTGGCACAGTTCCGCTTCCTGCAGCGTTT
ATTATTTGTGCATGGTCGCTGGGCCTACCGTCGAGTGGCAAAGCTCATGAGCTATATGCTCTACAAGAACGTGACATACGTGCTTACAACTTTTTGGTTT
GGCTGCTTCTGCGGATTCTCCGGTCAGCCTCTTATTCTGGACGTAGCCGCACAGAGCTTCAATGTTCTGTACACGAGCGTGCCGTTGGTTCTCTTTGCTG
TGTTTGACCAAGACGTATCGTCTACAAGTGCTGCTAAGTTTCCGTACCTGTACGCACTCGGTCAAAAGAACGTACTCCTCCGTCGCCGTGTATTCTGGCC
ATGGATCTTGAATGGCGTTTGGCACTCGCTTGTCATTTTCTTTGTTTCTGCCTGGGCTTTTGAGGGCTTTGGCCTAAGCATCCGCGATTTCCCGGTTATA
GCCACGGAGACAGGAAAAGGTGGTGGTCTCGTCACTTTGGGATTCGTGGTGTTTACGAACCTGGTGATAGTCGTGAACCTGAAGCTTTGTCTCGAAACGT
TCATGCTTACGTGGCAGTTCCTGTCGACAGTAACCGTGTCAGTGTTATTGTGGTTCGCCGTTGGCTCCTTCATTTCGTTACCAAACACTGGGTTTCCGCA
AGCAACTGGTGAAATGGAGTATCTCCAAGAATTGCCGACCTTCTGGCTTGTGTGTCTCCTAGTGTTGTCGTTGAGCCTGTTACGTGATGCTCTTTGGAAG
ATCGTGCGCCGGTTTTCGCTGCCCTCTATGTACCATATTCTTCAGGAGCGTGAGTTGATGGGCTTGCCAAATTCTCCTCGAGGTATGCTGCGCGAGCATC
GACGATCTGTATCGAATACGGCATGGTCTGACATACCCGCTACAGTTGTGGACTACGCCAAGCTATTCGGCAATATGCCGCGACTGGAAAGTCCGGAGGA
GACGCTTATGCGCTCCTCTCCACTTGGTGAGAGGTTAATCGCGTCACCTTTTTCCTCTTCAAGCGGCGGGGACACTATTAATCCTGATCATGCAGCAGGT
TTCCAAAGTCGCGAGAAGAAGCGTAACATCCGCATACGCGGGTCATTTCATGCCATTGGAAGCAGCGACAGCTTTGGTGCGGGCGTAGAGCCATCGTTCC
TTGAAGCTCCAGGGTCAGTTGCAGCGACAGTCACAGCGGGTGCTGGAGTTGGGGCGCGTTCGTCATCGTTCGTTGGGGTGCCTGGGGCTCAATACCACGG
CTACGCTTTTTCGGAGGACGAGAACGTGGACAGTGACGTTGAGGCAGCTTCCTCCAGCACGACCCGAGGCGATCTTGACCAGGCGAGGACGGCAGCATTT
GGGCATTCGTCGATCAAGAAGGTGCTCAAATCAGTTCGCGGTAGAAAGAATGCGTAAAGTGTTGATTTTACATAGATTGTGATTCAGAAATGAGTGAAGA
CAATGCTG