Transcript Name :
Phyci_88695
Orientation:
(+)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat400SM00028
Tetratricopeptide repeat1.3SM00028
Tetratricopeptide repeat0.0082SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-643
NN-scoreoddsWeighted Score
0.5212.4920.005
*** None ***
TypeScore
cytoplasmic304
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2317 bases(100 bases per row)
CCACACTAGACAAGCATGAGTGACGTACAATCGCTGAGCGACTCGCCGGCGTCGTCCGTGGGGCTCGGCAACTCGCTCATGTGGGAGAAGGTGGCTCTGT
CGCCGCTGGAGCTGCTGTCGGTGCAGCTGGAACACGAGCTGCAGCACGCTGAGGAGGTGGCAGCCGCTGCTGCGGCCGGCAAACAGAACAAGAACGGCGT
GGACGTGGACGCCAAGACGGGCAAGGCGGCCGGGCGCGTGACGGTGGAGGTGCTGGCGGCCAAGGAACTGGCGCTGGACAAGAACGCCGCAGTGCTGGCT
GCCAGCGGCAGCTCCGAGCCGGAGCTGTACGTGTCCACGCAGGTGACGCCGCTGTCGGCGTTCGAGAAGTCCACCAAGAAGCACCTGCGCACAGCCGGCG
TGCAGGCGGTGGACAATGCGAGCGCTAGCTGGAAGGAGGCGCTGGTGTACGAAGGTGCTAAGACCAAGAAGTTCGGCATCAAGGTCTCGCTCAGCAGCAG
CGCCGAGGTGATTGCCGACGTGGTGCTCGGAGAGCTGGAGCTGCGCGGCGCTGACTTCGAGGACCAGCTGCCGCACGAGAAGTGGTTCGACCTGAAGGCG
CCGGCGTCTGCGGCCACGACTGGCGTCTCTGGAAAGCTGTTGCTGCGTGTCACGTTCGAGTACTCGGTGCGCGAGCGCCACGAACGCGAGGTGGCCCTGC
TCCGCCAGAAGAAGCGCGAAAACGACGACGACATCGAACGGTATAAGACTACCGCGCGACAGGTAAATGCGCCGGTGAGGCACCCTGCGGCGTTCGGCAA
GGACACGGCCAAGGCCGCGCTTTACCTGCCTGGCAACAAGTTCCGCATCGACGCACACCACCCTGCTGCGGTGAGCGTGGCCCCTCTGGCCGACAAGACT
CGTATTGTGACTCCGTTCGGACGGGGCGTCGTTGTGTCCTTCCGGCCGGAGACCAAGATGTACGTGGTGCAGATGGATACGGACGCTGCGTCCAGGAACC
ACACCATCGCGTACTTGCGCCAGAACGTCGTGAAGGAGGAGCCCGATGAGCCACACCTCCGCATGCACATGAAGGTGGCGACACCGTACGGCCTGGGCGT
GCTGGAGGAGATCCGCCCGCATGACGACGTCTTGATCGTGAAGACGAACTACGCGCGCATGTTCATGCAGCGCAAGGACGTCAAGCTGCCGGTGAAGGAC
ATCTCGGAGATGTCGACGAAGGACCTGGTGGGCGAAGCCATTAAGCTCGCGGACACCGGCAACGAGGAGTTCCGCGAAGGTAAGCTGCAGGACGCCATTT
ACAGTTACCTGCGCTCGCTGGGCTTCCTCCAGCGCGTGGACCAGGACAACGCGACCCACAAGGAGAAGGCGACGATCATCCAGACCATGATCCGCTGCCA
CCTCAACATCGGCGCGTGCAAGCTCAAGCTCAACATGTACGCGGACGCCGAGATCGCGTGCACGAACGCGCTGAGCATCCTCACGGTGCTGGCCGATAAC
CGCGAGGGCAACGTCGTGACGTGGATGGGTCGGCTGGGAATGTCCGAGCAGCTTATGTTCGAGGACTGGCCCTCCAAGGCGCGCTTCCGCCGCGCGCAGG
CGTGCGTGAAGCTGGAGAAGTACGCGGACGCCAAGCAGGATCTGCTGCTGGCGGTCAAGCTGAACCCTCGCGACAAGTCGTGCCGCACGCTGCTGGACAA
GGTGAGCAAGCTCGTGGACAAGCAGAAGCGCGACGAGAAGAAGGCCTGGGGCGGCATCTTCGACACCCTCGACGCGTCGGCCTCGACCATCAAGACGACG
ACCACCAAGACCCAGAGTGGCGAGGAGAAGTCCATCTTCACGCGGACGACCAAGGCGCAGCGCCAGCAGCAGCAGGCCGCAGCTGCTGCCGTCGCCAAGA
ACGAAGCGGAGCCGTGGTACTTGACCACGCGCGCGCTGGCCACCGCGTCGGTGGTGACGGCGGGCGTGGCGGCCGTCGCGCTGCTGGCCTTGAAGCCCAA
GAGCTCGTAATCGGCGAGCGCCGGTGTCCCCTGCCGCTTCAACTGCTTCAACTTGCGGGGTGCTGGCTCTCTTGGGGCGGCATGCCCTGCGAGTAGGCAG
AGTCGAGCGACCGCGCTGCCGTCTCCAAGCCAGGCTGGCTGCTTGCAGGGCGCACCGAGGGGAAAGCAACAGTCTCTGCTGCAGCTGCGGCTGCGACAGG
ACGCGCGCCAACGTGTGGACGCGAGCGCCGCGAGGACCTTGCTCGACGCGCCGTATAACTCGCGCCCACTCGCTTTAGCACCACCGAGGCAAATACAGCA
GATGCTTTAGTCCATTG