Transcript Name :
Phyci_550278
Orientation:
(-)
Number of Exons:
1
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-130
NN-scoreoddsWeighted Score
0.6275.7550.012
*** None ***
TypeScore
mitochondrial391
GO
*** None ***
*** None ***
*** None ***
Sequence
        882 bases(100 bases per row)
ATGTTTCCTGCCATGCAGAACGATGGTCATATAGCGCCGGTGTTGCACCTTTGCTTAGCGTCTATTGTGGAGCATGTGGCGTTTTTGAAAAGCCATCTCG
AGCAAAACATCCGCTCTGGTCGTCCTACGTTTTTCTCtatccggaggtattggctagactacgaggctctcttcttacagagggtagttcatggatgcgg
ccaaccggcattcctcctcacattgacctctttcagcagcatgctgaaactcacaccgctctacgtcagctgcctgatgtgctgttagatgggtttggta
agttactggaagaccgatgtgtcggtcgtgaaagtattacatgcgaaacactaggttctacaattcgtgcactactggaggaagctggattgtagcgctc
tcaagactctggccgcgaagaggcttcgccccaatacccaagcagcactacctattactggccctctgatggccgattccaccgtgtgcccaacgacttc
aagtttccgcagctcgatgcgctgggcgtatggcgattgtggtggctaggtaatccagcagccggttttcctccgtttcgagcactgcatgcctccgatt
ttgctgcctcgaaccgcaagatgtattcggagtggtcagtgctcgtgcgccacattatggacggcgtggaaaccggaggaggagtaaatgtgcatcgtcc
tccaggtcaggaggaggtagatcgcctctatcacctagggatggcaaacatggcgtaaagccatctgcccacccgcacaaacagcgtctcgatcgagctg
ttaccacgctgcgtcgtatccgggaggctattcacgatgccaatccagatgcacgctccgtcgcctttcgtcacagaaagcg