Transcript Name :
Phyci_88684
Orientation:
(+)
Number of Exons:
1
Description :
tetratricopeptide repeat protein, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain26.676PS50293
Tetratricopeptide repeat10.443PS50005
Tetratricopeptide repeat9.676PS50005
Tetratricopeptide repeat7.641PS50005
Tetratricopeptide repeat5.34PS50005
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat0.012SM00028
Tetratricopeptide repeat4.3SM00028
Tetratricopeptide repeat0.04SM00028
Tetratricopeptide repeat480SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1030
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3240 bases(100 bases per row)
AGGTCACTTTTCAACGGAAGAGATGTCGGACGCGGACGACTTGATGCAGGAGCTGTGCGGCGTGAGCCTCTCGGCCATCGACAGCTCGCAAGATGCTGCG
CAGGACCTGCTGGAGCAGCGCCTGCTCGCGCTGGAGCGCGCGGTGCTGGAGAGCGACACCAAGAGCGTTGTCAAGGCGCAGGACGCGCTCCAGGACGGCG
ACGACGTGGCTCCAGTGCTGACAATGGCAAAGCTCATCTGCGAAGGCGAATACGCGGACGTCATCCGCCTGCAGCAGTCGCAGAAGCTTTTCCAGGCGGT
CGCCCAACTGCGCAGCGAGGAGCAGGACGAAGAGGACGACGACGCGCACATCTGCGGTAGCATCGCGTCGGCGCTGCAGAGCTACCTGCTGGACCAATGC
GACAGCGCCGAGAGCCGCCTCGTGGCCGCGTACGAGATCCTGTTCATTGGCGTCGCCTTCTTCGACATGTACGTGCAGGCCAACTACACGGGACCGGCAT
TCGAGAAGGAGACGCTGCGTGACCTACTGGATCTGTCCACGCACTTCGTGACCTGCTCTACCGAAAGCAACGACAAGAAGACTCATAGCGACGCGCTGGT
GGCGCTGCAGGTCGATGGCGAAAGTCCGTTCTCCATCTGTGAGTACCCGCAGTTTTTGCTCATTGGTCGCTGCTTGCTGGGCTTCGTGGGCAACCACGCG
TACAACGACTGGTCGGTGGCTGCTACCGAGGTGGTGCGCGGCGAGAACGATAACGAAGTCCCGGATGAGGCTGTGGAAGGACCTGCTAAGCGCCAGATTA
CTGGTGGGGCCGCTATCCGCGCACTTAGCGAGATGTTGGAGCAGATCCAGTCGGCTGCGTGGTGGAATGCGCGTGCTGCTGTGGCACACGAACGACTGCT
GCTTGCGAAGCAGCCATCGAACACGCTGTGGTTTGAAGCTCGTCGTGGCTACATTCAAACACTGAAAACGACCAAGCTTTTTGCCTTTGAGAAGGATTCA
CAATACCTGCTGGCTCGCGCGTACGTGGAGTGGGGCCTTGCGCAGCACCACTTCGACAAGAACAAGCGTGGAAAGTCTACGTTCGCGCGTGCCAAGGAGA
TATCTGGTGTGAGCGTGCAGCTCAGCGGATCCCTGGGTAAGCGTACCAAGTTCCAACGCAAGAGCTTGGCTCAGATGGTGCTTCTTGCGGCATCCAAGAA
AGAGCCTGAGAGTGAGGACAAAGAGTCTATCTACGCCACTGCCGTGGCTGAATCGACTCACGTGGACTTTGGCGGTAAGCAAGTGGTGGCGGAAGACGAA
GGTGAAAATGGCGCTGAGTCTTCTGCTGCCCCACCTGCCGATGGCCTTACGACGGAGGAGGAGCACATTCAAAGGCTAGTTCAAGAAGGCGAGGCTTCTT
ATCGCGACGTCAAATTGGACCAGGTGGACCAAGACAACTATCTCCTAGAGAGCATTGCATTTGAAGACCGTAAGCTCACGGAGCAGGGCAACCTGCAGAC
CGTCGACCAGATCGTGCTATTGGGACTTTGTCTGGATGTGAAGAACAGTAACGCCAACGATGGTCTCACACGCGAGGAGATGATGCCCTACGTGACGCGT
GTGCTGGAAAACCCCAACAACTGGATGGTGTACTCTACGGCGCTACTGGAACGCGCATGGCTTGAATGCGAGAGCTCGAAGCGCCGTGAACGCGCTGTTT
TGCAGATGCAGGCCTTGGTGGATCAGCACACAACGCGACTCACGATCACGCAAAACACCCTGCAGTCCATTGCGGATTCTGCACCAGCACGTGAACGCAT
GCAGTTTGTGTATTCGCTGGCGTTCCCTCCGCGGTATGCCCTCAAGCGTGACCTGGCTGAGCGCTACTTCAAGCTTGGTGTTCTAGGCAGTGCTGTTGAA
ATTTGCGAGGAGCTGGAGATGTGGGATGATGTCGTCAAGTGCTACCAGCTTTTGGACAAACCGATGCGTGCTGAAAGGCTTGTGCGGGAGCGTCTGGAGA
TCGCCGCCACGCCATTTATGTGGGTCACGTTGGGAGATCTCACTCAGGAGCCTTCGCACTACGAGACAGCCTGGGCACTATCGAAACAGAGATTTGCTCG
GGCCAAGCGTTCACTCGGACGCTACTACTTCGACAAGGGCGACCCCGATGCGGCTATCCCCCACTACGAGGATGCCGTGCGTGTTGGTCCCATGCACACT
GGTGCTTGGTTCACTCTTGGAGCGATGGCGATGCGTGTGCACCGGTGGGCACTCTCCATGCGTGCGTTCACGCGCGTGGTGCAGCTCGAGCCGGACAATG
GTGAGGCATGGGGCAACCTAGGCTCTATCCATTTACACAACCAGCGCTTTGCGGAGGCCTTCGCGGTGCTGGAGGAGGCTCTCAAGCAGAAGCGTCACAT
GTGGCAGATGTGGGAAAACTACGCGTTGTGTGCCATGGAGACCAAACGCTACGGTGAGGCAATGTACGCGATGCACCAACTGCTTGACATGCGCGCCAAG
CACAAGCGCCCGGTCGACAGTGAAATGCTGGCGTGGCTCGTCGAGGCCATTGTGTATCCCGAATCGCTGAAGAAGATGGAGCAGGAGGCTGCTGCCGAGG
TCGGTGCAATTGAAAAGGACGAAGACGAGGACGAGGTTGACCAGCTCGACGATGACGACGATGAAGACCTGGCAGAGCTGGACGAGACCGCAGCCGCCAC
TGACGCGACGCCACCGCGGTCCGACACGCACTACAAGAAGCAGCTGGCTATGCTGTTCGGCCGCGTGACGTCCATCGTGACCAACGACGCCAAGGTGTGG
CAGGTGTACGCGCACTTCAACGACGGCCTCGAGGGCCGCGCCGACAAGGCGCGTGACTGCCGCCTGAAGCAGTGCCGCGCTCTGCAAGTCGCCGGCTGGG
AGCGAGAGGAGCAGAAGGTGAAGGACCTGTGCTCGGCAGCCTCTCGCCTGGCGCAGGACTACCTGGAGGAGGGCACCAAGAAGGCGCTGTACTCGTGCCG
GCTGTACATCCGCGGCGTGCTCAAGAAGGCGCAGGTGGACTTCCCCGAGCTGGAGGCGGTGCAGGCGCTCGCCGCCGCGCTGGACGAGGTCAACGCCAGG
GAGGCGCAGCTGTAGACAGATACGTACGTAGAGATAGACGTCCTCAATGGGGAGACATCCTGCACATGACCCACCAATGTAGCCATCTGTAGCCCTAGCA
GATACGCCTAGCTCGTTTTTGTCCAATGACACGTCTTCTC