Transcript Name :
Phyca_LT1534128189
Orientation:
(+)
Number of Exons:
1
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-397
NN-scoreoddsWeighted Score
0.5631.4210.003
*** None ***
TypeScore
cytoplasmic739
GO
*** None ***
*** None ***
*** None ***
Sequence
        1191 bases(100 bases per row)
atgtccaaggaccgattcagtgtcaagccgtatccggatctgcaagtgtctgaagacgagcgctaccaattgattgagctcgttaatgggttcgtgaaag
accatttccaggaatacgaggactttgtgctcgtaagcaagagtcaagtggacgaacagagatggaaacacgtcaagtccaaggacaaccagcacgtgta
ctcggagcgtccccacaaggaacacaagaccaccgaacaaacagtctcttgggatcccaccactgctgctgttcagaaagatttacccgtggttctgagt
gtcggaacgttagtgggggacgttgacgacgtcatgttcggcgtggtgaatcctacgttagatgtcatgcggatcaaggcgtcatacgtgcacgaccttg
acagtgcggctgtcctgtgctcagtggtcgagccaagtgtggacgaacctttccagtctctcgttatcaagtggatgaccatcgatttacctctacagtc
taccagtttagtcaaaagccgagatttcgtctacattgaagcgacgggggtcgtgcactttaccaacggcgagcgtgtgggttaccacttgctgcattcg
attgacttcccgcagaccaagccactggccaatatgatccgaggaaacctatcagtatttggttttttccgccagattgagcccaatactattgatattt
acgccagtggcacggtcgttcccggtgggaagatcgcgcgctttatatgcatccaagtctctgcggaagcgctgctttccgcgacaaattacgtgtattg
tggccagatgaaaaagttgtcgtggatgttgcagcaccgacattcagcagtcgaccgacatggtaaaaccaatggagaaaagtgcgttgtatgtgaccgg
aaggtaacaaaaggcatccgagggttgatcggagcgagcacgtgtaaactttgctatgagagcgtgtgttattcgtgcaaagttcgcaaacgaattagct
ttattgctctggatgggcaacttcttcgacgaaagatctcgttctgcacgaaatgcgtgaatgaaacgaccaaatgggacgcgaaagaagcagccagaga
tcaggcaacgggttatcgagcgtacaaagccttctcgacatcctcacagtccgataccaggagcacagaaagcttgccatttttcgattga