Transcript Name :
Phyca_LT153411261
Orientation:
(+)
Number of Exons:
3
Description :
conserved unknown protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-427
NN-scoreoddsWeighted Score
0.6632.0260.004
*** None ***
TypeScore
cytoplasmic348
GO
*** None ***
*** None ***
*** None ***
Sequence
        1410 bases(100 bases per row)
atgacatctccagcggtagtgacgactctgctgcagtggcttgaggctaatggaggcgtcgacagtctgctggacattcgttatctggggaaactcgagg
gtcacggcgtgttcgcaaagcagaatctgtccagcggccaagtgacgctgcgagttccgttcaaactcacgatgaacacggaatccgcatctcaatcgga
tattgcacccgtactggagaaatatccgcagattccagacgatgaggtattggcgttgcatttaatgcacgagcgcagcaaaggcgcagactcgttcttc
gccccgttcattgcgtcgctgcccaccacgttcgacttgccggttttctggtcagaactcgagttgaacgaacttcaaggcaccaacgtgctgctattga
cacgattgatgaagcagcatttgcagagggattttgataatatccaccaagcggtagtggacgatttcccagagatttttgcgtcactgccgacaattac
gttggaggactacacgtgggccatgagtgtgatctggagtcgcgcctttggagttactaggggagagaagtatctgcgcgtattgtgcccagcaatggat
atgttcaaccacgacgtgagcttgcgcaacccactggatgacttcgtctcatttgatgaggagaagcaaatgctgactcaccatgtgccaaacgctgtta
ctgctggatcaccgctgcacatcagctacgggcaatactcaaatgccaagctattgtactcatacggattcgttgcaaaggcgaaccaccgccgtgcagt
ggatttctggatgaagatcccgcccaacgacccgtatctaaagctcaagcagactgttattgactcaaatgagcttaccaacaaccaaacatacgatttt
tgcggaaccctcttcaaagacgacgttgatgagaggctcctggctacgctgagagtgattctgatgaccgaacaagaaattcgcttgtacaagaaggtaa
agtttttttacgaggaaactcctgcaacttaccttcctgtggtatggtggaataggcatttgagaaggaaatgcttagcactcgcaatgagctcgcagta
tatgaaaacctgcagaacagttgccgccgcaagctcgctaattattcgactacgtacgtgccccaggccaaagtcattcggtgctgaactaacgtgaaat
gtgttgcaaattgtcggtaacagacttgaggaggatgaagcgatcttggctgaaactgaaaccgaatcgaaccctcgcctggccttcgcggttcgtgtcc
gcattgaggacaagcaagtgtttacaggcgtcattcacaccctcgagcagtggaagcagtcgcttacatccaaccccgagaaataccctccgagcactac
acgtttgtaa