Transcript Name :
Phyca_LT1534126938
Orientation:
(-)
Number of Exons:
2
Description :
syntaxin 7-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Target SNARE coiled-coil domain13.176PS50192
HmmSmart predictionP-Valprediction_id
Target SNARE coiled-coil domain1.4SM00397
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-200
224-225
201-223
NN-scoreoddsWeighted Score
0.661.2440.002
*** None ***
TypeScore
nuclear304
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
1495
Sequence
        736 bases(100 bases per row)
atgtcgctgttcggaacaccgcaggactcacgagccaaccacaaccagatcaaagaactcacagagaagggaaataaactcgtggcgaagatcaaccgcc
gtctacaggagcttaaccgtggagccaagggagctgctggacgcacgcgacgtactcaggtgaataaactctcggcggactttaagaaccaagtgcgcgt
gttcgaggagacgtgcgaacggctgctcgagtccgagcgacagtcggtggaattcattcgacgctcctcgcagagtttcaagggtagcaacggccgacag
acgcgtggaggggcagagtttaccaactacagtgaggaccagatctacgcacaggctaatgtggtcatttacgatgaagacggtgcgttgattgtgtgaa
ttaaaatgaggagagagttctgacgactttttttgccttacagatctgcagaggagagaggacgatatcatccagattaatcaccagcttcgcgaggtga
atgctgcgttcgaagagatcgatggacttgtacaggaccagggagagatggtggttgagatcgtggacaatacagagacagccaaggacaacgtggagaa
ggcactcgagcaggtgaagcaggcggacgagcgcagaaaatgttgcgcttgctcaaagatgaagctcatttgcatcgccattttcgcgctgcttatcttt
atcgccctcatgggcatcattttcgctgccaagtaa