Transcript Name :
Phyca_LT1534126858
Orientation:
(+)
Number of Exons:
2
Description :
TonB-dependent receptor
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-695
NN-scoreoddsWeighted Score
0.6221.920.004
*** None ***
TypeScore
nuclear957
GO
*** None ***
*** None ***
*** None ***
Sequence
        2154 bases(100 bases per row)
atgaaacgactggagtgtggggtgggctacgaggatgactcaactcaagtcagtgactcaggtgaatcgagcgaagacgatatgatgatgacaccttggc
agcaaatgacacagacgttcggaatggggaaagctgctcgaccccagcggggtaatgggcggcgatcaagcatttcatccgtttcccaggtcgaccgcct
atcagtgacgcaaaagagcatgaagcagatcataccaacccccaggagcctcaaacaagttatcaccgagtacttcctgcgtggaaacaaaaaggttcag
ccctcgaaacccacagaagaactcgctttggctgagcatatccggttgatggaagcaaaactgaacatgatgcgatcaactcggtgcaatgcaggccctc
ctctaaagcgaggagattgtgataaccttcgtgttgtctacgaacggtcccccgaagggattcgtgcttacggcacagtctcaaaacgagtggaagatgg
cagctacgctgtcgttactgaagacgaacacggtatttcagcgcagatggtacctcaagatatggtggacttcttgccgtctgtaaatgaactggaacag
caactgacagacctcgagcgaacacaacgtgtcttctttgctggacaaagggtccaagtatcgctgtatcctggcagtcgcttctccggtcgtgggctta
ttactcttgaacgagaataccagtcacgctttcacgtgctactagcgaaccgtattcgactagcaaacgttccggtggacaagataagccctctggtaga
gaaaaagagagccgcggtgactatcacggaagaccaatttctcgtgtgcagtaacaaggtcaaagtgtacattggcgaccagatttacgtcaagtgttca
gctggaaatggcgattttgacagcacctgcgaggacgagaagcttgggcttcttaacggcgtctactcgaacaaaactgcagcggttgactttgcagatg
gttccactggatatgaaattcctccgcagcttatctttaaacgcaaacgcaggaatgttcctgcagatcaagatgtgcggtctcttaagaacgccgtcct
tatgcaggcttcagctgcacacggcggaggaaaagaggctctcccagtactggaggaaggataccaggtcaaagctgatcacccgcgcaaggctgccgtt
gaaagctgcattgtgatcaaaacgcacgcttcttcagcttgtgatctccgtttttcggatggtacgatcgcatttgaggtgtttccgtcacaaatgatca
tcgacagcgtggagcatcagcgaactgccaacactcacacaaatgaaacctccaaccgagcgcaatatacgccagtgtttgccgtcggagactacgtgct
tgcttggagctcgcgctttggacgctactgttcagccaaaattgttgccaaaacgtctcaagaccctagtaatgggccagcatcttcatcgtctcctaca
gctcatgtcattgccatcgctgcagtgcaaactgagctatacaagttggtattcgactacggcgagctgaaagctcacatgtcacccgataaaatcacta
ctctggatgatatggccgcgttgtaccatacacaacggttaaccaactacagcattgacacgatggggtttgagctctctccagtgagtttcaccgttgg
ggaattggtcatgggccgcgtacatggaacagcaagatacttcaatggtgtagtcgaatcggtggacgagaaagagcgagtctgtgcggtttgtttcgac
tcatcggagcgtgacactgcagttcccttctctgccatgttttcgatcgactcaaggccacatctcgcaagcagaagttctagtaccaagcaagtaggag
gtggcgctagttcgtcttcggaggcggcgtcaagaacccaattcctttcacgtcaacgcagtacggaaactacagcaccctcagaagcaaactcaagacg
tcgacgacacagcagttcatcaatgggaaacatgctcaagtctgtgactgataacttgttccgaagctcgcgatccaaaagaaaccttgacacacgccga
ggctcgcacatgatcaccgaaattggagctcatctccgactcgaggaacagtag